[ Sitemap ] [ Kontakt ] [ Impressum ] [ ] Volltext Suche Chemie


Home


Weiteres zum Thema:

Photochemie

Buecher zum Thema


Themenbezogene Artikel

- Biolumineszenz

- Chemie, allgemein

- Fluoreszenz

- Fotosynthese

Weitere Themenbereiche

English Version


Verwandte Themen:

Physikalische Chemie


Aktuelles

Chemie Nachrichten

Stellenmarkt Chemie

Chemie Konferenzen


Chemie A bis Z

Index Chemie

Chemikalien

Internetchemie Lexikon

Produkte und Firmen


About Internetchemie

Internetchemie

Impressum

Service




Photochemie - Neueste Forschungsartikel der Fachverlage


 
Aktuelle Fachartikel zur Photochemie und Photobiologie, sortiert nach Erscheinungsdatum.

Die Urheberrechte und Veroeffentlichungsrechte der in der nachfolgenden Liste aufgefuehrten Fachartikel liegen bei den jeweiligen Verlagen, die am Ende des jeweiligen Artikels als Quelle genannt werden. Diese sind auch fuer die Inhalte verantwortlich.

Hinweise zur Veroeffentlichung Ihrer Pressmitteilung unter Internetchemie.Info entnehmen Sie bitte der entsprechenden Info-Seite.

Diese Seite koennen Sie mit folgender Tastenkombination nach Stichwoertern durchsuchen: <STRG> und <F>.


Auf dieser Seite beruecksichtige naturwissenschaftliche Journale:


Photochemical & Photobiological Sciences - published by The Royal Society of Chemistry -
PPS meets the growing information needs of scientists working in the areas of photochemistry and photobiology, and indeed, encourages a synergism between these two important research areas. This international journal is published monthly on behalf of the European Photochemistry Association (EPA), the European Society for Photobiology (ESP), the Asia and Oceania Society for Photobiology (AOSP) and the Korean Society of Photoscience (KSP), and is available in both print and electronic formats.

Photochemistry and Photobiology - published by Wiley-Interscience -
... publishes original research articles and reviews on current topics in photoscience.



Aktuelle wissenschaftliche Fachartikel der genannten Journale:


Regulation and Disregulation of Mammalian Nucleotide Excision Repair: A Pathway to Nongermline Breast Carcinogenesis

Abstract

Nucleotide excision repair (NER) is an important modulator of disease, especially in constitutive deficiencies such as the cancer predisposition syndrome Xeroderma pigmentosum. We have found profound variation in NER capacity among normal individuals, between cell-types and during carcinogenesis. NER is a repair system for many types of DNA damage, and therefore many types of genotoxic carcinogenic exposures, including ultraviolet light, products of organic combustion, metals and oxidative stress. Because NER is intimately related to cellular metabolism, requiring components of both the DNA replicative and transcription machinery, it has a narrow range of functional viability. Thus, genes in the NER pathway are expressed at the low levels manifested by, for example, nuclear transcription factors. As NER activity and gene expression vary by cell-type, it is inherently epigenetically regulated. Furthermore, this epigenetic modulation is disregulated during sporadic breast carcinogenesis. Loss of NER is one basis of genomic instability, a required element in cellular transformation, and one that potentially influences response to therapy. In this study, we demonstrate differences in NER capacity in eight adult mouse tissues, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

Thumbnail image of graphical abstract

We have shown profound variation in NER (Nucleotide Excision Repair) capacity in humans, between cell-types and during carcinogenesis. As NER is intimately related to both replication and transcription, it shows a narrow range of functional viability. NER activity and gene expression are epigenetically regulated, although this epigenetic modulation is disregulated during sporadic breast carcinogenesis. We now demonstrate differences in NER capacity in eight adult mouse tissues, including a complete lack of activity in brain, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

Quelle: Photochemistry and Photobiology | 19 Dec 2014 | 7:07 am CET

Interaction of crown ether-annelated styryl dyes with double-stranded DNA

Abstract

DNA-binding properties of 15-crown-5-derived mono- and bis-styryl dyes were investigated in the presence of calf thymus DNA. To access the factors that influence the DNA association in the series of these ligands, the structure of the molecules was varied by either changing size of the heterocyclic moiety or altering the position of the styryl substituents. The major binding mode for the monostyryl dyes is intercalation. Notably, binding of the dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54. Therefore, these cationic styryl derivatives may be applied as fluorescent ‘light-up’ probes for DNA detection.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 18 Dec 2014 | 10:17 pm CET

Protein-Encapsulated Bilirubin: Paving the Way to a Useful Probe for Singlet Oxygen

Photochem. Photobiol. Sci., 2014, Accepted Manuscript
DOI: 10.1039/C4PP00408F, Paper
Frederico M Pimenta, Jan Kristian Jensen, Michal Etzerodt, Peter R Ogilby
When dissolved in a bulk solvent, bilirubin efficiently removes singlet molecular oxygen, O2(a1[capital Delta]g), through a combination of chemical reactions and by promoting the O2(a1[capital Delta]g) [rightward arrow] O2(X3[capital Sigma]g-) nonradiative transition to populate...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 18 Dec 2014 | 1:00 am CET

Study of the Fenton-mediated Oxidation of Methylene Blue-Cucurbit[n]uril Complexes

Photochem. Photobiol. Sci., 2014, Accepted Manuscript
DOI: 10.1039/C4PP00362D, Paper
Tomas Fuenzalida, Denis Fuentealba
Cucurbit[n]urils efficiently decreased the Fenton-mediated oxidation of encapsulated dyes providing a mechanism for some control and selectivity over the degradation. The encapsulation of methylene blue into cucurbit[7]uril made it highly...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 17 Dec 2014 | 1:00 am CET

Response of growth and photosynthesis of Emiliania huxleyi to visible and UV irradiances under different light regimes

Abstract

Microalgae are capable of acclimating to changes in light and ultraviolet radiation (UVR, 280-400nm). However, little is known about how the ecologically important coccolithophore Emiliania huxleyi responds to UVR when acclimated to different light regimes. Here, we grew E.huxleyi under indoor constant light or fluctuating sunlight with or without UVR, and investigated its growth, photosynthetic performance and pigmentation. Under the indoor constant light regime, the specific growth rate (μ) was highest, while fluctuating outdoor solar radiation significantly decreased the growth rate. Addition of UVR further decreased the growth rate. The repair rate of photosystem II (PSII), as reflected in changes in PSII quantum yield, showed an inverse correlation with growth rate. Cells grown under the indoor constant light regime exhibited the lowest repair rate, while cells from the outdoor fluctuating light regimes significantly increased their repair rate. Addition of UVR increased both the repair rate and intracellular UV-absorbing compounds. This increased repair capability, at the cost of decreased growth rate, persisted after the cells were transferred back to the indoor again, suggesting an enhanced allocation of energy and resources for repair of photosynthetic machinery damage by solar UVR which persisted for a period after transfer from solar UVR.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 2:36 pm CET

Unveiling the triplet state of a 4- amino-7-Nitrobenzofurazan Derivative in cyclohexane

Abstract

The nitrobenzofurazan (NBD) moiety has gained tremendous popularity over the last decades due to its fluorogenic nature. Indeed, upon interaction with aliphatic amines, it generates a stable fluorescent adduct, which has been used for protein and lipid labeling. In fact the 4-amino substituted NBD belongs to the broad family of intramolecular charge transfer molecules, with the amino group acting as an electron donor upon photoexcitation, and the nitro group as an electron acceptor. Whereas the singlet excited state of 4-amino NBD derivatives has been abundantly studied, investigation of its triplet manifold is scarce and even the absence of intersystem crossing for this type of molecules has been suggested. However, intramolecular charge transfer molecules are known to undergo intersystem crossing and high phosphorescence quantum yields have been reported in non-polar solvent. In the present paper, we have investigated the photophysical and photochemical properties of N-hexyl-7-nitrobenzo[c][1,2,5]xadiazole-4-amine. We have shown the existence of a triplet state for this molecule in cyclohexane via nanosecond laser flash photolysis. Interestingly, deactivation of the triplet state leads to photoproducts formation, which are only present in the absence of oxygen.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 2:35 pm CET

Photophysics of Acetophenone Interacting with DNA: Why the Road to Photosensitization is Open

Abstract

Deoxyribonucleic acid photosensitization, i.e. the photoinduced electron- or energy-transfer of chromophores interacting with DNA, is a crucial phenomenon that triggers important DNA lesions such as pyrimidine dimerization, even upon absorption of relatively low-energy radiation. Oxidative lesions may also be produced via the photoinduced production of reactive oxygen species. Aromatic ketones, and acetophenone in particular, are well known for their sensitization effects. In this contribution we model the structural and dynamical properties of the acetophenone/DNA aggregates as well as their spectroscopic and photophysical properties using high-level hybrid quantum mechanics/molecular mechanics methods. We show that the key steps of the photochemistry of acetophenone in gas phase are conserved in the macromolecular environment and thus an ultrafast singlet–triplet conversion of acetophenone is expected prior to the transfer to DNA.

Thumbnail image of graphical abstract

Using a combination of Molecular Dynamics and QM/MM modeling we have characterized stable interaction modes between acetophenone and DNA. The effects of the macromolecular environment on the acetophenone photophysics have been elucidated, confirming that it is still able to efficiently photosensitize DNA by energy transfer from triplet state. In particular this is due to the maintaining of the quasidegenerescence between the first two acetophenone triplet states that are moreover characterized by a high spin-orbit coupling with the ground state. Our work gives important insights in the triplet sensitization mechanism and on the effect of the environment.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 9:55 am CET

Recent Advances in the Application of Chlorophyll a Fluorescence from Photosystem II

Abstract

In the photosynthesis process, part of the absorbed photon energy in photosystem II (PSII) may be reemitted as chlorophyll a fluorescence (ChlF). Environmental and plant physiological changes affect the emission of ChlF, which makes ChlF a potentially useful tool to sense these changes. Volumes of research on ChlF are published each year and some published work has been controversial. To facilitate the application of ChlF, it is important to have a holistic picture of the field. This review summarizes ChlF applications published in the last 10 years.

Thumbnail image of graphical abstract

This review summarizes the literature on the applications of chlorophyll a fluorescence from photosystem II of plants published in the latest 10 years. Areas of application covered include: (1) plant senescence, damage, virus and diseases; (2) nutrient status; (3) salt stress; (4) chilling stress; (5) heat stress; (6) herbicides; (7) metal pollution; (8) aquatic ecosystems; (9) drought stress and (10) selection of stress-resistant species.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 9:55 am CET

MicroRNAs and Photocarcinogenesis

Abstract

As a new class of sequence-specific regulators of gene expression, the microRNAs (miRNA) form a regulatory network with growth factors and transcription factors participating in various biological processes. It is now being recognized that the various key processes involved in cancer induction are under the control of these small noncoding RNAs, which regulate ~30% of all human genes by targeting sequences in their 3′-untranslated regions. Photocarcinogenesis is a complex interplay of signaling events in the UV exposed human skin including DNA damage and repair, apoptosis, cell survival, mutations and the immune system. In this review, we have scrutinized the role of miRNAs in skin cancer biology focusing on the three most common types of skin cancer namely the basal cell carcinoma, squamous cell carcinoma and cutaneous malignant melanoma. An overview of these studies will be useful in gaining insights into the mechanisms of cancer development in the human skin. A better understanding of the functionality of miRNAs will have enormous implications to risk assessment, and to target interventions against signaling events involved in photocarcinogenesis.

Thumbnail image of graphical abstract

The modulation of gene expression in UV exposed human skin under the regulatory control of small noncoding miRNAs adds an additional layer of complexity to the process of skin carcinogenesis. An in-depth knowledge of the functionality of miRNAs in the human skin will have enormous implications to risk assessment, and to target interventions against signaling events involved in photocarcinogenesis.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 7:14 am CET

Thioredoxin Reductase Activity may be More Important than GSH Level in Protecting Human Lens Epithelial Cells Against UVA Light

Abstract

This study compares the abilities of the glutathione (GSH) and thioredoxin (Trx) antioxidant systems in defending cultured human lens epithelial cells (LECs) against UVA light. Levels of GSH were depleted with either L-buthionine-(S,R)-sulfoximine (BSO) or 1-chloro-2,4-dinitrobenzene (CDNB). CDNB treatment also inhibited the activity of thioredoxin reductase (TrxR). Two levels of O2, 3% and 20%, were employed during a 1 hr exposure of the cells to 25 J/cm2 of UVA radiation (338-400nm wavelength, peak at 365nm). Inhibition of TrxR activity by CDNB, combined with exposure to UVA light, produced a substantial loss of LECs and cell damage, with the effects being considerably more severe at 20% O2 compared to 3%. In contrast, depletion of GSH by BSO, combined with exposure to UVA light, produced only a slight cell loss, with no apparent morphological effects. Catalase was highly sensitive to UVA-induced inactivation, but was not essential for protection. Although UVA light presented a challenge for the lens epithelium, it was well-tolerated under normal conditions. The results demonstrate an important role for TrxR activity in defending the lens epithelium against UVA light, possibly related to the ability of the Trx system to assist DNA synthesis following UVA-induced cell damage.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 15 Dec 2014 | 11:06 am CET

Catechin as a new improving agent for photo-Fenton-like system at near-neutral pH for the removal of inderal

Photochem. Photobiol. Sci., 2014, Accepted Manuscript
DOI: 10.1039/C4PP00371C, Paper
Zongping Wang, Yizhou Guo, Zizheng Liu, Xiaonan Feng, Yiqun Chen, Tao Tao
Photodegradation of inderal in a photo-Fenton like system at near-neutral pH modified with catechin, a natural catecholate siderophore, was investigated under simulated sunlight. Main factors influencing the process, such as...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 15 Dec 2014 | 1:00 am CET

Environmental considerations on solar disinfection of wastewater and the subsequent bacterial (re)growth

Photochem. Photobiol. Sci., 2014, Accepted Manuscript
DOI: 10.1039/C4PP00266K, Paper
Stefanos Giannakis, Efthymios Darakas, Antoni Escalas-Canellas, Cesar Pulgarin
In this work, solar disinfection of wastewater was studied, focusing in the potential environmentally induced issues that are involved in the process. The subjects under question were i) the applied...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Dec 2014 | 1:00 am CET

Light-Regulated MicroRNAs

Abstract

In addition to exposure to passive diurnal cycles of sunlight, humans are also subjected to intentional acute exposure to other types of electromagnetic radiation (EM). Understanding the molecular mechanisms involved in the physiological, pathological and therapeutic responses to exposure to radiation is an active area of research. With the advent of methods to readily catalog and identify patterns of changes in gene expression, many studies have reported changes in gene expression upon exposure of various human and mouse cells in vitro, whole experimental organisms such as mice and parts of human body. However, the molecular mechanisms underlying these broad ranging changes in gene expression are not yet fully understood. MicroRNAs, which are short, noncoding RNAs that regulate gene expression by targeting many messenger RNAs, are also emerging as important mediators of radiation-induced changes in gene expression and hence critical for the manifestation of light-induced cellular phenotypes and physiological responses. In this article, we review available knowledge on microRNAs implicated in responses to various forms of solar and other EM radiation. Based on this knowledge, we elaborate some unifying themes in the regulation and functions of some of these miRNAs.

Thumbnail image of graphical abstract

Exposure to different types of electromagnetic radiation is sensed by cells through various light-absorbing molecules such as opsins, cryptochromes and DNA. Activation of specific second messengers and signaling pathways lead to changes in expression of several genes including microRNAs (miRNA) and miRNA processing enzymes. Altered levels of miRNAs produce pleotropic effects by fine-tuning cellular levels of multitude of mRNAs leading to manifestation of EM radiation-induced phenotypes.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:44 pm CET

Beyond Xeroderma Pigmentosum: DNA Damage and Repair in an Ecological Context. A Tribute to James E. Cleaver

Abstract

The ability to repair DNA is a ubiquitous characteristic of life on Earth and all organisms possess similar mechanisms for dealing with DNA damage, an indication of a very early evolutionary origin for repair processes. James E. Cleaver's career (initiated in the early 1960s) has been devoted to the study of mammalian ultraviolet radiation (UVR) photobiology, specifically the molecular genetics of xeroderma pigmentosum and other human diseases caused by defects in DNA damage recognition and repair. This work by Jim and others has influenced the study of DNA damage and repair in a variety of taxa. Today, the field of DNA repair is enhancing our understanding of not only how to treat and prevent human disease, but is providing insights on the evolutionary history of life on Earth and how natural populations are coping with UVR-induced DNA damage from anthropogenic changes in the environment such as ozone depletion.

Thumbnail image of graphical abstract

Sunlight is one of the most ubiquitous hazards for life on Earth. Although some aspects of solar radiation are beneficial (e.g. photosynthesis, vision, vitamin D synthesis), the ultraviolet B (UVB) component causes substantial damage to DNA resulting in debilitating and lethal effects. All organisms are capable of repairing DNA photoproducts and repair pathways are remarkably similar. While DNA repair research often focuses on human diseases and the development of cancer; solar DNA damage is also an important component of ecosystem health and stability. This review provides an overview of DNA repair in non-mammalian taxa relative to ambient UVB stress.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:44 pm CET

The Efficient Photocatalytic Degradation of Methyl Tert-butyl Ether Under Pd/ZnO and Visible Light Irradiation

Abstract

Methyl tert-butyl ether is a commonly used fuel oxygenate that is present in gasoline. It was introduced to eliminate the use of leaded gasoline and to improve the octane quality because it aids in the complete combustion of fuel by supplying oxygen during the combustion process. Over the past decade, the use of MTBE has increased tremendously worldwide. For obvious reasons relating to accidental spillage, MTBE started to appear as an environmental and human health threat because of its nonbiodegradable nature and carcinogenic potential, respectively. In this work, MTBE was degraded with the help of an advanced oxidation process through the use of zinc oxide as a photocatalyst in the presence of visible light. A mixture of 200 mg of zinc oxide in 350 mL of 50 ppm MTBE aqueous solution was irradiated with visible light for a given time. The complete degradation of MTBE was recorded, and approximately 99% photocatalytic degradation of 100 ppm MTBE solution was observed. Additionally, the photoactivity of 1% Pd-doped ZnO was tested under similar conditions to understand the effect of Pd doping on ZnO. Our results obtained under visible light irradiation are very promising, and they could be further explored for the degradation of several nondegradable environmental pollutants.

Thumbnail image of graphical abstract

The photocatalytic degradation of aqueous MTBE solution was studied using zinc oxide as a photocatalyst. Complete MTBE removal was achieved within 9 h under visible light irradiation using ZnO particles. MTBE removal is attributed to the visible light excitation of the photocatalyst resulting in the generation of photoexcited electron/hole pairs. This method can be considered as an efficient and complete removal system of MTBE from water.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:38 pm CET

Minimum Exposure Limits and Measured Relationships Between the Vitamin D, Erythema and International Commission on Non-Ionizing Radiation Protection Solar Ultraviolet

Abstract

The International Commission on Non-Ionizing Radiation Protection (ICNIRP) has established guidelines for exposure to ultraviolet radiation in outdoor occupational settings. Spectrally weighted ICNIRP ultraviolet exposures received by the skin or eye in an 8 h period are limited to 30 J m−2. In this study, the time required to reach the ICNIRP exposure limit was measured daily in 10 min intervals upon a horizontal plane at a subtropical Australian latitude over a full year and compared with the effective Vitamin D dose received to one-quarter of the available skin surface area for all six Fitzpatrick skin types. The comparison of measured solar ultraviolet exposures for the full range of sky conditions in the 2009 measurement period, including a major September continental dust event, show a clear relationship between the weighted ICNIRP and the effective vitamin D dose. Our results show that the horizontal plane ICNIRP ultraviolet exposure may be used under these conditions to provide minimum guidelines for the healthy moderation of vitamin D, scalable to each of the six Fitzpatrick skin types.

Thumbnail image of graphical abstract

The relationship between vitamin D dose and the International Commission on Non-Ionizing Radiation Protection (ICNIRP) UV exposure is studied from measurements made in Southern Queensland, Australia. The measurements take into account all weather and atmospheric conditions including a major continental dust storm event (NASA MODIS Terra image, 23 September 2009). Personal minimum exposure guidelines for the optimal production of vitamin D are presented for each of the internationally recognized UV index ranges relative to the received ICNIRP exposure. The measured data show that the healthy production of vitamin D can be maintained at subtropical latitude without exceeding ICNIRP exposure guidelines.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:37 pm CET

Abbreviations and glossary

Photochem. Photobiol. Sci., 2015, 14,10-13
DOI: 10.1039/C4PP90041C, Editorial

The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Dec 2014 | 1:00 am CET

Preface

Photochem. Photobiol. Sci., 2015, 14,7-8
DOI: 10.1039/C4PP90039A, Editorial

The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Dec 2014 | 1:00 am CET

Environmental effects of ozone depletion and its interactions with climate change: 2014 assessment

Photochem. Photobiol. Sci., 2015, 14,14-18
DOI: 10.1039/C4PP90042A, Editorial

The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Dec 2014 | 1:00 am CET

Environmental effects of ozone depletion and its interactions with climate change: 2014 assessment

Photochem. Photobiol. Sci., 2015, 14,9-9
DOI: 10.1039/C4PP90040E, Editorial

The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Dec 2014 | 1:00 am CET

Effects of Substituents on Synthetic Analogs of Chlorophylls. Part 4: How Formyl Group Location Dictates the Spectral Properties of Chlorophylls b, d and f

Abstract

Photosynthetic organisms are adapted to light characteristics in their habitat in part via the spectral characteristics of the associated chlorophyll pigments, which differ in the position of a formyl group around chlorin macrocycle (chlorophylls b, d, f) or no formyl group (chlorophyll a). To probe the origin of this spectral tuning, the photophysical and electronic structural properties of a new set of synthetic chlorins are reported. The zinc and free base chlorins have a formyl group at either the 2- or 3-position. The four compounds have fluorescence yields in the range 0.19–0.28 and singlet excited-state lifetimes of ~4 ns for zinc chelates and ~8 ns for the free base forms. The photophysical properties of the 2- and 3-formyl zinc chlorins are similar to those observed previously for 13-formyl or 3,13-diformyl chlorins, but differ markedly from those for 7-formyl analogs. Molecular-orbital characteristics obtained from density functional theory calculations were used as input to spectral simulations employing the four-orbital model. The analysis has uncovered the key changes in electronic structure engendered by the presence/location of a formyl group at various macrocycle positions, which is relevant to understanding the distinct spectral properties of the natural chlorophylls a, b, d, and f.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 9 Dec 2014 | 10:11 am CET

Nobiletin, a polymethoxy flavonoid, reduced endothelin-1 plus SCF-induced pigmentation in human melanocytes

Abstract

Nobiletin is unique flavonoid having polymethoxy groups and has exhibited anti-inflammatory and anti-obesity effects. Here we examined the inhibition of nobiletin on melanogenesis induced by endothelin-1 (ET) and stem cell factor (SCF) in normal human melanocytes. Nobiletin dose-dependently reduced ET plus SCF-stimulated tyrosinase activity without causing cytotoxicity. Nobiletin reduced cAMP-response element-binding protein (CREB) phosphorylation and microphthalmia-associated transcription factor (MITF) expression, which is a key transcription factor for tyrosinase expression in pigmentation induced by ET plus SCF stimulation. Nobiletin treatment effectively decreased ET plus SCF-induced Raf, MEK, and ERK phosphorylation and also down-regulated the forskolin-induced phosphorylation of CREB. Furthermore, nobiletin inhibited ET plus SCF-triggered production of melanin and expression of MITF/tyrosinase in a three-dimensional human epidermal model. In accordance with protein expression, the expression of genes related to the pigmentation was also increased in the cells stimulated with ET plus SCF and the co-treatment with nobiletin decreased obviously the ET plus SCF-triggered gene expressions of tyrosinase, PMEL, TRP1, and MITF. Nobiletin contributes to hypopigmentation by downregulating MITF and tyrosinase expression through reduced Raf-1 phosphorylation. Our findings implicate nobiletin as a potential new whitening agent.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 9 Dec 2014 | 10:08 am CET

Ultraviolet Index and Location are Important Determinants of Vitamin D Status in People with Human Immunodeficiency Virus

Abstract

This study aimed to document the vitamin D status of HIV-infected individuals across a wide latitude range in one country and to examine associated risk factors for low vitamin D. Using data from patients attending four HIV specialist clinics across a wide latitude range in Australia, we constructed logistic regression models to investigate risk factors associated with 25(OH)D < 75 nmol L−1. 1788 patients were included; 87% were male, 76% Caucasian and 72% on antiretroviral therapy. The proportion with 25(OH)D < 50 nmol L−1 was 27%, and <75 nmol L−1 was 54%. Living in Melbourne compared with Cairns (adjusted odds ratio (aOR) 3.30; 95% CI 2.18, 4.99, < 0.001) and non-Caucasian origin (aOR 2.82, 95% CI 2.12, 3.75, < 0.001) was associated with an increased risk, while extreme UV index compared with low UV index was associated with a reduced risk (aOR 0.33; 95% CI 0.20, 0.55, < 0.001) of 25(OH)D < 75 nmol L−1. In those with biochemistry available (n = 1117), antiretroviral therapy was associated with 25(OH)D < 75 nmol L−1; however, this association was modified by serum cholesterol status. Location and UV index were the strongest factors associated with 25(OH)D < 75 nmol L−1. Cholesterol, the product of an alternative steroid pathway with a common precursor steroid, modified the effect of antiretroviral therapy on serum 25(OH)D.

Thumbnail image of graphical abstract

Low vitamin D is commonly found in people with HIV. This figure presents the unadjusted proportions of people with 25(OH)D <75 nmol L−1 grouped by UV index categories and the four different study locations in Australia [Cairns (latitude 17°S), Nambour (27°S), Brisbane (28°S) and Melbourne (38°S)]. In this study, we describe these and other factors contributing to serum 25(OH)D levels in people with HIV in Australia. Antiretroviral therapy was also associated with 25(OH)D <75 nmol L−1 which appeared to be modified by cholesterol and warrants further exploration in future studies.

Quelle: Photochemistry and Photobiology | 9 Dec 2014 | 7:22 am CET

Transition from Charge-Transfer to Largely Locally Excited Exciplexes, from Structureless to Vibrationally Structured Emissions

Abstract

Exciplexes of 9,10-dicyanoanthracene (DCA) with alkylbenzene donors in cyclohexane show structureless emission spectra, typical of exciplexes with predominantly charge-transfer (CT) character, when the donor has a relatively low oxidation potential (Eox), e.g. hexamethylbenzene (HMB). With increasing Eox and stronger mixing with a locally excited (LE) state, vibrational structure begins to appear with 1,2,3,5-tetramethylbenzene and becomes prominent with p-xylene (p-Xy). A simple theoretical model reproduces the spectra and the radiative rate constants, and it reveals several surprises: Even in this nonpolar solvent, the fractional CT character of a highly mixed exciplex varies widely in response to fluctuations in the microscopic environment. Environments that favor the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. It is known that sparsely substituted benzene radical cations, e.g., p-Xy•+, are stabilized more in acetonitrile than the heavily substituted HMB•+. Remarkably, ion pairing with DCA•– in cyclohexane leads to even larger differences in the stabilization of these radical cations. The spectra of the low-Eox donors are almost identical except for displacements that approximately equal the differences in Eox, even though the exciplexes have varying degrees of CT character. These similarities result from compensation among several nonobvious, but quantified factors.

Thumbnail image of graphical abstract

Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (Eox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher Eox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-Eox spectra is illusory, resulting instead from several compensating factors.

Quelle: Photochemistry and Photobiology | 8 Dec 2014 | 7:01 am CET

Vitamin D and Skin Cancer

Abstract

Vitamin D signaling plays a key role in many important processes, including cellular proliferation, differentiation and apoptosis, immune regulation, hormone secretion and skeletal health. Furthermore, vitamin D production and supplementation have been shown to exert protective effects via an unknown signaling mechanism involving the vitamin D receptor (VDR) in several diseases and cancer types, including skin cancer. With over 3.5 million new diagnoses in 2 million patients annually, skin cancer is the most common cancer type in the United States. While ultraviolet B (UVB) radiation is the main etiologic factor for nonmelanoma skin cancer (NMSC), UVB also induces cutaneous vitamin D production. This paradox has been the subject of contradictory findings in the literature in regards to amount of sun exposure necessary for appropriate vitamin D production, as well as any beneficial or detrimental effects of vitamin D supplementation for disease prevention. Further clinical and epidemiological studies are necessary to elucidate the role of vitamin D in skin carcinogenesis.

Thumbnail image of graphical abstract

Vitamin D production and supplementation have been shown to exert protective effects in several diseases and cancers, including skin cancer. While ultraviolet B (UVB) radiation is the main etiologic factor for skin cancer, UVB also induces cutaneous vitamin D production. This paradox has been the subject of contradictory findings in the literature in regards to amount of sun exposure necessary for appropriate vitamin D production, as well as any beneficial or detrimental effects of vitamin D supplementation for disease prevention. Further clinical and epidemiological studies are necessary to elucidate the role of vitamin D in skin carcinogenesis.

Quelle: Photochemistry and Photobiology | 8 Dec 2014 | 6:55 am CET

A theoretical study of the UV absorption of 4-methylbenzylidene camphor: from the UVB to the UVA region

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00392F, Paper
Luis Pinto da Silva, Paulo J. O. Ferreira, Margarida S. Miranda, Joaquim C. G. Esteves da Silva
A theoretical methodology was used to characterize the UV absorption of the photo-stable UVB filter, 4-methylbenzylidene camphor. This study resulted in the design of two novel UVA filters.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 8 Dec 2014 | 1:00 am CET

Improved Efficiency and Stability of Flexible Dye Sensitized Solar Cells on ITO/PEN Substrates Using an Ionic Liquid Electrolyte

Abstract

Flexible dye-sensitized solar cells (DSSCs) built on plastic substrates have attracted great interest as they are lightweight and can be roll-to-roll printed to accelerate production and reduce cost. However, plastic substrates such as PEN and PET are permeable to water, oxygen and volatile electrolyte solvents, which is detrimental to the cell stability. Therefore, to address this problem, in this work, an ionic liquid (IL) electrolyte is used to replace the volatile solvent electrolyte. The initial IL-based devices only achieved around 50% of the photovoltaic conversion efficiency of the cells using the solvent electrolyte. Current-voltage and electrochemical impedance spectroscopy (EIS) analysis of the cells in the dark indicated that this lower efficiency mainly originated from (i) a lack of blocking layer to reduce recombination, and (ii) a lower charge collection efficiency. To combat these problems, cells were developed using a 12nm thick blocking layer, produced by atomic layer deposition, and 1 μm thick P25 TiO2 film sensitized with the hydrophobic MK-2 dye. These flexible DSSCs utilizing an IL electrolyte exhibit significantly improved efficiencies and a less than 10% drop in performance after 1000 hours aging at 60ºC under continuous light illumination.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 9:21 am CET

Application of CdTe/ZnSe Quantum Dots in In Vitro Imaging of Chicken Tissue and Embryo

Abstract

The present work is aimed to synthesize CdTe/ZnSe core/shell quantum dots (QDs) in an easy way and to explore the possibilities of its application in in vitro imaging of chicken tissue and embryo. The QDs were prepared using microwave irradiation with different temperatures, which is a very easy and less time-consuming method. Subsequently these QDs were characterized by spectrofluorimetry, Transmission Electron Microscopy, X-ray fluorescence analysis and Dynamic Light Scattering measurement. A blue-shifting of the emission was found when ZnSe was deposited on CdTe QDs. The QDs showed its fluorescence emission quantum yields up to 25%. They were applied into chicken embryos and breast muscle tissues to study their efficiency in in vitro imaging. All the QDs of different color were able to visualize in in vitro imaging. The highest fluorescence intensity was detected in the case of red QDs prepared at 100 °C. The green and red QDs were possible to detect up to the depth of 3 and 4 mm of the tissue respectively.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 9:20 am CET

Efficacy of Low-Dose Ultraviolet A-1 Phototherapy for Parapsoriasis/Early-Stage Mycosis Fungoides

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 8:01 am CET

In Vitro Photodynamic Inactivation Effects of Ru(II) Complexes on Clinical Methicillin-resistant Staphylococcus aureus Planktonic and Biofilm Cultures

Abstract

Photosensitizers (PSs) combined with light are able to generate antimicrobial effects. Ru(II) complexes have been recognized as a novel class of PSs. In this study, we investigated the effectiveness of photodynamic inactivation (PDI) mediated by three Ru(II) polypyridine complexes, 1–3, against four isolates of clinical methicillin-resistant Staphylococcus aureus (MRSA-1, MRSA-2, MRSA-3 and MRSA-4). In PDI of a planktonic culture of MRSA-1, compound 3 showed the highest efficacy, likely owing to its advantageous light absorption, 1O2 quantum yield and bacterial cellular binding. The PDI efficacy of 3 was further evaluated against all other strains and MRSA-1 biofilms. At appropriate PS concentrations, viability reduction of 100% or 96.83% was observed in planktonic or biofilm forms of MRSA, respectively. The mechanisms of action were investigated using negative staining transmission electron microscopy (TEM), confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM). It was demonstrated that PDI of planktonic bacteria was achieved primarily through damage to the cell envelope. Biofilms were eliminated through both the destruction of their structure and inactivation of the individual bacterial cells. In conclusion, Ru(II) complexes, especially 3, are potential candidates for the effective photodynamic control of MRSA infections.

Thumbnail image of graphical abstract

Photodynamic inactivation (PDI) is a compelling alternative treatment for infections, especially those caused by multidrug-resistant bacteria. In this study, a novel class of cationic photosensitizers, Ru(II) complexes, has been tested in their PDI effects against clinical methicillin-resistant Staphylococcus aureus (MRSA) strains, both in planktonic and biofilm cultures. Mechanisms of the PDI process were also investigated. It was demonstrated that PDI of planktonic bacteria was achieved primarily through damage to the cell envelope. Biofilms were eliminated through both the destruction of their structure and inactivation of the individual bacteria.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 7:59 am CET

Combination of Er:YAG Laser and CO2 Laser Treatment on Skin Tissue

Abstract

Skin is the most important organ in our body, as it protects us from external environmental effects. Study the ability of the skin to stretch and the histological examinations of irradiated tissues have significant values in scientific and medical applications. Only a few studies have been done to study the correlation between epidermis ablation and the changes that occur at dermal levels when using dual lasers in ablative resurfacing mode. The aim of this work is to determine this correlation and to estimate the effects of multiple pulses on induced collagen remodeling and the strength of skin exposed with dual lasers in an in vivo rat model. All laser exposures led to mark improvement in the skin's strength compared to their own controls. The histological investigation indicated that there was a thickness loss in the epidermis layer with the induction of deep collagen coagulation in the dermis layer as the dual laser pulses increased. Additionally, more collagen fibers were remolded in the treated samples by dual wavelengths. We conclude that by combining dual lasers with multiple pulses targeted at not only the epidermis layer of the skin, it could also induce some heat diffusion in the dermis layer which causes more coagulation of collagen fibers. The tensile results confirmed by our histological data demonstrate that the strength of irradiated skin with dual wavelengths increased more than using both lasers separately on the skin tissue since more collagen is induced.

Thumbnail image of graphical abstract

The skin is an important body-organ, protecting us from external environmental effects. Studies concerning the ability of skin to stretch and histological examinations of irradiated tissues have significant values for scientific and medical applications. Only few studies have been done to study the correlation between epidermis ablation and the changes that occur at dermal levels when using dual lasers in ablative resurfacing mode. The aim of this work is to determine this correlation and to estimate the effects of multiple pulses on induced collagen remodeling and the strength of skin exposed to dual lasers in an in vivo rat model.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 7:55 am CET

ß-Ga2O3 Nanorod Synthesis with a One-step Microwave Irradiation Hydrothermal Method and its Efficient Photocatalytic Degradation for Perfluorooctanoic Acid

Abstract

ß-Ga2O3 nanorod was first directly prepared by the microwave irradiation hydrothermal way without any subsequent heat treatments, and its characterizations were analyzed by X-ray diffraction (XRD), scanning electron microscope (SEM), high-resolution transmission electron microscope (HRTEM), UV–Vis diffuse reflection spectroscopy techniques, and also its photocatalytic degradation for perfluorooctanoic acid (PFOA) was investigated. XRD patterns revealed that ß-Ga2O3 crystallization increased with the enhancement of microwave power and the adding of active carbon (AC). PFOA, as an environmental and persistent pollutant, is hard decomposed by hydroxyl radicals (HO·); however, it is facilely destroyed by ß-Ga2O3 photocatalytic reaction in an anaerobic atmosphere. The important factors such as pH, ß-Ga2O3 dosage and bubbling atmosphere were researched, and the degradation and defluorination was 98.8% and 56.2%, respectively. Reductive atmosphere reveals that photoinduced electron may be the major reactant for PFOA. Furthermore, the degradation kinetics for PFOA was simulated and constant and half-life was calculated, respectively.

Thumbnail image of graphical abstract

ß-Ga2O3 was first synthesized via the microwave irradiation hydrothermal way and then was used to degrade PFOA under the UV light. Decomposition procedure involved the adsorption of PFOA on the surface of ß-Ga2O3 and the degradation. ß-Ga2O3 prepared by the microwave irradiation hydrothermal method owned the powerful photocatalytic degradation performance for PFOA and degradation kinetics constant was 0.0425 min−1.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 7:54 am CET

Low-level laser (light) therapy increases mitochondrial membrane potential and ATP synthesis in C2C12 myotubes with a peak response at 3-6 hours

Abstract

Low level laser (light) therapy has been used before exercise to increase muscle performance in both experimental animals and in humans. However uncertainty exists concerning the optimum time to apply the light before exercise. The mechanism of action is thought to be stimulation of mitochondrial respiration in muscles, and to increase adenosine triphosphate (ATP) needed to perform exercise. The goal of this study was to investigate the time course of the increases in mitochondrial membrane potential (MMP) and ATP in myotubes formed from C2C12 mouse muscle cells and exposed to light-emitting diode therapy (LEDT). LEDT employed a cluster of LEDs with 20 red (630 ± 10 nm, 25 mW) and 20 near-infrared (850 ± 10 nm, 50 mW) delivering 28 mW/cm2 for 90 sec (2.5 J/cm2) with analysis at 5 min, 3 h, 6 h and 24 h post-LEDT. LEDT-6h had the highest MMP, followed by LEDT-3h, LEDT-24h, LEDT-5min and Control with significant differences. The same order (6h>3h>24h>5min>Control) was found for ATP with significant differences. A good correlation was found (r=0.89) between MMP and ATP. These data suggest an optimum time window of 3-6 h for LEDT stimulate muscle cells.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 1 Dec 2014 | 8:43 am CET

Photophysics and photochemistry of cis- and trans-hydroquinone, catechol and their ammonia clusters: a theoretical study

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00356J, Paper
Mitra Ataelahi, Reza Omidyan, Gholamhassan Azimi
CC2 PE profiles of the bare and ammoniated hydroquinone (HQ-An, n = 0-4) at the electronic ground (S0) and S1 (1[small pi][small pi]*) excited states along with the O-H reaction coordinate.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 1 Dec 2014 | 1:00 am CET

Solar ultraviolet radiation and ozone depletion-driven climate change: effects on terrestrial ecosystems

Photochem. Photobiol. Sci., 2015, 14,88-107
DOI: 10.1039/C4PP90034K, Perspective
J. F. Bornman, P. W. Barnes, S. A. Robinson, C. L. Ballare, S. D. Flint, M. M. Caldwell
We summarise advances in our knowledge of how UV-B radiation (280-315 nm) together with other climate change factors interact in their influence on terrestrial organisms and ecosystems.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 1 Dec 2014 | 1:00 am CET

Effects of ultraviolet radiation (UVA+UVB) and copper on the morphology, ultrastructural organization and physiological responses of the red alga Pterocladiella capillacea

Abstract

The effect of ultraviolet (UV) radiation and copper (Cu) on apical segments of Pterocladiella capillacea was examined under two different conditions of radiation, PAR (control) and PAR+UVA+UVB (PAR+UVAB), and three copper concentrations, ranging from 0 (control) to 0.62, 1.25 and 2.50 μM. Algae were exposed in vitro to photosynthetically active radiation (PAR) at 70 μmol photons m−2s−1, PAR + UVB at 0.35 W m−2 and PAR +UVA at 0.70 W m−2 during a 12-hour photocycle for 3 h each day during 7 days. The effects of radiation and copper on growth rates, content of photosynthetic pigments, and photosynthetic performance were analyzed. In addition, samples were processed for light and transmission electron microscopy. The content of photosynthetic pigments decreased after exposure to radiation and Cu. Compared with PAR radiation and copper treatments modified the kinetics patterns of the photosynthesis/irradiance curve. The treatments also caused changes in the ultrastructure of cortical and subcortical cells, including increased cell wall thickness and accumulation of plastoglobuli, as well as changes in the organization of chloroplasts. The results indicate that the synergistic interaction between UV radiation and Cu in P. capillacea, led to the failure of protective mechanisms and causing more drastic changes and cellular imbalances.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 3:56 pm CET

UV Signature Mutations

Abstract

Sequencing complete tumor genomes and exomes has sparked the cancer field's interest in mutation signatures for identifying the tumor's carcinogen. This review and meta-analysis discusses signatures and their proper use. We first distinguish between a mutagen's canonical mutations—deviations from a random distribution of base changes to create a pattern typical of that mutagen—and the subset of signature mutations, which are unique to that mutagen and permit inference backward from mutations to mutagen. To verify UV signature mutations, we assembled literature datasets on cells exposed to UVC, UVB, UVA, or solar simulator light (SSL) and tested canonical UV mutation features as criteria for clustering datasets. A confirmed UV signature was: ≥60% of mutations are C[RIGHTWARDS ARROW]T at a dipyrimidine site, with ≥5% CC[RIGHTWARDS ARROW]TT. Other canonical features such as a bias for mutations on the nontranscribed strand or at the 3′ pyrimidine had limited application. The most robust classifier combined these features with criteria for the rarity of non-UV canonical mutations. In addition, several signatures proposed for specific UV wavelengths were limited to specific genes or species; UV's nonsignature mutations may cause melanoma BRAF mutations; and the mutagen for sunlight-related skin neoplasms may vary between continents.

Thumbnail image of graphical abstract

Inverse relationship of canonical mutation patterns and mutation signatures for inferring the mutagen from mutations. Two mutagens are illustrated. A mutagen's canonical mutations deviate from random base changes, establishing a pattern typical for that mutagen. Different mutagens can produce the same canonical mutations (non-informative mutations). Signature mutations are the subset of canonical mutations that, in addition, are unique to that mutagen and permit inference backward from mutations to mutagen. A mutagen therefore produces signature mutations plus non-informative mutations. The latter are real and are produced by the mutagen, but are not useful for identifying that mutagen or carcinogen.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study

Abstract

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.

Thumbnail image of graphical abstract

G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K+ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Following Oxygen Consumption in Singlet Oxygen Reactions via Changes in Sensitizer Phosphorescence

Abstract

This work reports an examination of singlet oxygen reactions with amino acid substrates by a method involving measurement of the change in phosphorescence intensity of the singlet oxygen sensitizer. The sensitizer, a Ru(II) bipyridyl complex covalently linked to pyrene, has long-lived phosphorescence in N2 purged aqueous solutions (τ0 ~ 20 μs) that is nearly completely quenched by oxygen in aerated solutions. Irradiation of the complex in water containing sub mM concentrations of histidine, tryptophan and methionine results in a dramatic, easily visible increase in the phosphorescence intensity over a period of 10–100 s. Rate constants for singlet oxygen oxidation of each of the substrates can be obtained by using changes in the phosphorescence intensity in initial rate kinetic analysis. Rate constants obtained in this way compare favorably with those reported in the literature. The method represents a very simple approach for obtaining rate constants for singlet oxygen reactions with various substrates and the kinetics can be extended to nonaqueous solvents.

Thumbnail image of graphical abstract

Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Oxidatively Generated Damage to Cellular DNA by UVB and UVA Radiation,

Abstract

This review article focuses on a critical survey of the main available information on the UVB and UVA oxidative reactions to cellular DNA as the result of direct interactions of UV photons, photosensitized pathways and biochemical responses including inflammation and bystander effects. UVA radiation appears to be much more efficient than UVB in inducing oxidatively generated damage to the bases and 2-deoxyribose moieties of DNA in isolated cells and skin. The UVA-induced generation of 8-oxo-7,8-dihydroguanine is mostly rationalized in terms of selective guanine oxidation by singlet oxygen generated through type II photosensitization mechanism. In addition, hydroxyl radical whose formation may be accounted for by metal-catalyzed Haber–Weiss reactions subsequent to the initial generation of superoxide anion radical contributes in a minor way to the DNA degradation. This leads to the formation of both oxidized purine and pyrimidine bases together with DNA single-strand breaks at the exclusion, however, of direct double-strand breaks. No evidence has been provided so far for the implication of delayed oxidative degradation pathways of cellular DNA. In that respect putative characteristic UVA-induced DNA damage could include single and more complex lesions arising from one-electron oxidation of the guanine base together with aldehyde adducts to amino-substituted nucleobases.

Thumbnail image of graphical abstract

UVA predominantly generates singlet oxygen that selectively oxidize guanine leading to 8-oxo-7,8-dihydroguanine. Superoxide anion radical (inline image) is also produced as the precursor of H2O2 and subsequently of highly reactive hydroxyl radical (OH) that induces oxidized bases and single-strand breaks. Both UVA and UVB are able to trigger delayed biochemical responses including activation of enzymes, inflammation and bystander effects. As a result inline image and nitric oxide are released leading to the formation of OH and peroxynitrite. The latter species is expected through reaction with CO2 to produce the carbonate anion radical, an efficient one-electron oxidant of guanine.

Quelle: Photochemistry and Photobiology | 27 Nov 2014 | 12:31 pm CET

Pigment violet 19 - a test case to define a simple method to simulate the vibronic structure of absorption spectra of organic pigments and dyes in solution

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00317A, Paper
Benoit Champagne, Vincent Liegeois, Freddy Zutterman
PV19 quinacridone pigment reveals the important computational parameters to simulate the UV/vis absorption band shape of organic pigments in solution.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 Nov 2014 | 1:00 am CET

Interspecific Variation in the Repair of UV Damaged DNA in the Genus Xiphophorus as a Factor in the Decline of the Rio Grande Platyfish

Abstract

The fish genus Xiphophorus consists of 26 species distributed along the eastern slopes of mountain ranges extending from northern Mexico to Belize and Nicaragua. We analyzed light-dependent repair of UV-induced DNA damage in at least two species from each of the four monophyletic Xiphophorus groups. We found that the northern platyfish had significantly reduced photoenzymatic repair compared to the other three groups, including the northern swordtails, southern platyfish and southern swordtails. All of the species of the northern platyfish, including the Marbled (meyeri), Northern (gordoni) and Monterrey Platyfish (couchianus) are the northernmost species in the genus and are the only three species in the genus that are currently found on the IUCN Red List of Threatened Species. Satellite data from the past 30 years (1979–2008) correlate greater increases in shorter wavelength UVB with higher latitudes within the Xiphophorus range. We suggest that, combined with other consequences of human population growth, anthropogenic deozonation resulting in a disproportionate increase in UVB in temperate latitudes may be a contributing factor in the decline and extirpation of the northern platyfish.

Thumbnail image of graphical abstract

Geographical distribution of 26 species of the genus Xiphophorus with three northern species is highlighted. The three species comprising the Rio Grande Platyfish are the only Xiphophorus listed on the IUCN Red List of Threatened Species and this clade as a whole displays significantly reduced DNA repair compared to the other species in the genus.

Quelle: Photochemistry and Photobiology | 25 Nov 2014 | 7:50 am CET

Effective Photoprotection of Human Skin against Infrared A Radiation by Topically Applied Antioxidants: Results from a Vehicle Controlled, Double-Blind, Randomized Study

Abstract

Infrared A radiation (IRA) from solar sunlight contributes to photoaging of human skin, e.g. by upregulating MMP-1 expression in dermal fibroblasts, indicating the need for photoprotection of human skin against IRA. Up to now, however, there has been no controlled study to show that effective protection of human skin against IRA radiation is possible. Here, we have conducted a randomized, controlled, double-blinded prospective study in 30 healthy volunteers to assess the capacity of an SPF 30 sunscreen versus the same sunscreen supplemented with an antioxidant cocktail containing grape seed extract, vitamin E, ubiquinone and vitamin C to protect human skin against IRA radiation-induced MMP-1 upregulation. As expected, exposure to IRA radiation significantly upregulated MMP-1 expression, as compared to unirradiated skin, and this response was significantly reduced, if the SPF30 sunscreen plus the antioxidant cocktail had been applied prior to IRA radiation. In contrast, treatment of human skin with the SPF30 sunscreen alone did not provide significant protection. These results indicate that topically applied antioxidants effectively protect human skin against IRA radiation and that regular sunscreens need to be supplemented with specific antioxidants in order to achieve IRA photoprotection.

Thumbnail image of graphical abstract

Topical application of an SPF30 sunscreen containing an antioxidant mixture consisting of grape seed extract, vitamin E, ubiquinone and vitamin C significantly protects human skin (n = 30) against IRA radiation-induced MMP-1 mRNA expression.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:12 am CET

o-Amino Analogs of Green Fluorescence Protein Chromophore: Photoisomerization, Photodimerization and Aggregation-induced Emission

Abstract

The photochemical properties of three o-amino analogs of the green fluorescence protein chromophore O0, O1 and O8 (o-ABDIs) have been investigated and compared with those of the m- and p-amino isomers (m-ABDIs and p-ABDIs) in solutions, aggregates, and the solid state. In aprotic solvents, the fluorescence competes with the Z [RIGHTWARDS ARROW] E photoisomerization for all cases, and the o-ABDIs display a fluorescence quantum efficiency of 1–6%, lying between the m-ABDIs of 5–48% and the p-ABDIs of < 0.1%. The fluorescence of both the o- and m-ABDIs is nearly quenched in protic solvents, attributable to the solvent–solute hydrogen bonding (SSHB) interactions. The phenomenon of aggregation-induced emission observed for O8 in poor solvents resembles the behavior of M8 as a consequence of exclusion of the SSHB interactions and restriction of internal rotation for molecules located inside the aggregates. The occurrence of [2 + 2] photodimerization for O0 in the solid state is unique among the ABDIs, and the X-ray crystal structures of O0 and the photodimer OD reveal the head-to-tail syn-oriented stereochemistry. Analysis on the X-ray crystal structures of O0, O1, M0, M1 and P0 shows that not only the pairwise topochemical geometry but also the columnar packing mode is important in determining the photodimerization reactivity.

Thumbnail image of graphical abstract

The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:10 am CET

Synthesis, Structure and Photophysical Properties of Ferrocenyl or Mixed Sandwich Cobaltocenyl Ester Linked meso-Tetratolylporphyrin Dyads

Abstract

We report here the design and synthesis of porphyrin–metallocene dyads consisting of a metallocene [either ferrocene or mixed sandwich η5-[C5H4(COOH)]Co(η4-C4Ph4) connected via an ester linkage at meso phenyl position of either free-base or zinc porphyrin. All these dyad systems were characterized by various spectroscopic and electrochemical methods. A dimeric form of this molecule was observed in the X-ray crystal structure of Zn-TTPCo. The absorption spectra of all four dyads indicated the absence of electronic interactions between porphyrin macrocycle and metallocene in the ground state. However, interestingly, in all four dyads, fluorescence emission of the porphyrin was quenched (19–55%) as compared to their monomeric units. The quenching was more pronounced in ferrocene derivatives rather than cobaltocenyl derivatives. The emission quenching can be attributed to the excited-state intramolecular photoinduced electron transfer from metallocene to singlet excited state of porphyrin and the electron-transfer rates (kET) were established in the range 1.51 × 108 to 1.11 × 109 s−1. They were found to be solvent dependent.

Thumbnail image of graphical abstract

We have designed two new porphyrin–metallocene dyads, in which either ferrocene or mixed cobaltocenyl connected at meso position of porphyrin through ester linkage. Ground-state properties showed that there exists minimum π−π interactions between porphyrin and metallocene. Singlet state properties reveal that there is a photoinduced electron transfer from metallocene to singlet state of porphyrin.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:08 am CET

DNA Damage Checkpoint Responses in the S Phase of Synchronized Diploid Human Fibroblasts

Abstract

We investigated the hypothesis that the strength of the activation of the intra-S DNA damage checkpoint varies within the S phase. Synchronized diploid human fibroblasts were exposed to either 0 or 2.5 J m−2 UVC in early, mid- and late-S phase. The endpoints measured were the following: (1) radio-resistant DNA synthesis (RDS), (2) induction of Chk1 phosphorylation, (3) initiation of new replicons and (4) length of replication tracks synthesized after irradiation. RDS analysis showed that global DNA synthesis was inhibited by approximately the same extent (30 ± 12%), regardless of when during S phase the fibroblasts were exposed to UVC. Western blot analysis revealed that the UVC-induced phosphorylation of checkpoint kinase 1 (Chk1) on serine 345 was high in early and mid S but 10-fold lower in late S. DNA fiber immunostaining studies indicated that the replication fork displacement rate decreased in irradiated cells at the three time points examined; however, replicon initiation was inhibited strongly in early and mid S, but this response was attenuated in late S. These results suggest that the intra-S checkpoint activated by UVC-induced DNA damage is not as robust toward the end of S phase in its inhibition of the latest firing origins in human fibroblasts.

Thumbnail image of graphical abstract

When cells are exposed to UV, the ATR-Chk1-Cdc7-Dbf4 arm of the intra-S checkpoint is activated. In early and mid S, the checkpoint response is robust and DNA origin initiation is inhibited. However, this DNA damage effect is not seen in late-S phase cells.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 9:52 am CET

In Situ FTIR Spectroscopy Study of the Photodegradation of Acetaldehyde and azo Dye Photobleaching on Bismuth-Modified TiO2

Abstract

The photocatalytic properties of bismuth-modified titania were studied by photobleaching of two aqueous azo dyes solutions (Reactive Black 5 and Acid Orange 7), and by photoinduced decomposition (PID) of acetaldehyde using in situ FTIR spectroscopy. Low bismuth doping concentrations up to 3 at.% is shown to lead to an increased photobleaching rate of both azo dyes solutions. Too high Bi dopant concentrations lead to less developed crystallite nanoparticles and exhibit weaker adsorption capacity. Bismuth doping altered the adsorption kinetics of acetaldehyde resulting in different surface products, and a modified photocatalytic reaction pathway was inferred.

Thumbnail image of graphical abstract

The low-temperature process avoiding organometallic precursors and nonwater solvents was employed to produce Bi-doped titania nanoparticles. This method proceeds via peroxotitanium complexes and can be easily used for solution doping. Acetaldehyde adsorption and its photoinduced degradation was observed by in situ FTIR spectroscopy and revealed different photocatalytic behavior of doped samples compared to pure TiO2.

Quelle: Photochemistry and Photobiology | 21 Nov 2014 | 6:59 am CET

Photoisomerization of cis-1,2-di(1-Methyl-2-naphthyl)ethene at 77 K in Glassy Media

Abstract

cis-1,2-Di(1-methyl-2-naphthyl)ethene, c-1,1, undergoes photoisomerization in methylcyclohexane, isopentane and diethyl ether/isopentane/ethanol glasses at 77 K. On 313 nm excitation the fluorescence of c-1,1 is replaced by fluorescence from t-1,1. Singular value decomposition reveals that the spectral matrices behave as two component systems suggesting conversion of a stable c-1,1 conformer to a stable t-1,1 conformer. However, the fluorescence spectra are λexc dependent. Analysis of global spectral matrices shows that c-1,1 is a mixture of two conformers, each of which gives one of four known t-1,1 conformers. The λexc dependence of the c-1,1 fluorescence spectrum is barely discernible. Structure assignments to the resolved fluorescence spectra are based on the principle of least motion and on calculated geometries, energy differences and spectra of the conformers. The relative shift of the c-1,1 conformer spectra is consistent with the shift of the calculated absorption spectra. The calculated structure of the most stable conformer of c-1,1 agrees well with the X-ray crystal structure. Due to large deviations of the naphthyl groups from the ethenic plane in the conformers of both c- and t-1,1 isomers, minimal motion of these bulky substituents accomplishes cis [RIGHTWARDS ARROW] trans interconversion by rotation about the central bond.

Thumbnail image of graphical abstract

One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

Quelle: Photochemistry and Photobiology | 21 Nov 2014 | 6:53 am CET

Modeling of degradation kinetic and toxicity evaluation of herbicides mixtures in water using the UV/H2O2 process

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00269E, Paper
Melisa L. Mariani, Roberto L. Romero, Cristina S. Zalazar
A kinetic model to interpret the simultaneous oxidation of a mixture of herbicides (glyphosate and 2,4-D) in water using the UV/H2O2 process was proposed. Good agreement of the experimental data and the model were achieved.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 21 Nov 2014 | 1:00 am CET

Photocatalytic and photoelectrocatalytic degradation of the antibacterial agent ciprofloxacin

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00377B, Paper
Iosif Tantis, Leda Bousiakou, George-Albert Karikas, Panagiotis Lianos
Photocatalytic and photoelectrocatalytic degradation of the antibacterial fluoroquinolone drug, ciprofloxacin, has been studied in the presence of nanocrystalline titania films supported on glass slides or transparent electrodes.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 20 Nov 2014 | 1:00 am CET

A novel phthalazine based highly selective chromogenic and fluorogenic chemosensor for Co2+ in semi-aqueous medium: application in cancer cell imaging

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00358F, Paper
Smita Patil, Rahul Patil, Umesh Fegade, Banashree Bondhopadhyay, Umesh Pete, Suban K. Sahoo, Narinder Singh, Anupam Basu, Ratnamala Bendre, Anil Kuwar
A new phthalazine based chemosensor 3 was developed for the detection of Co2+.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Nov 2014 | 1:00 am CET

Absorption and Emission Sensitivity of 2-(2’-Hydroxyphenyl)benzoxazole to Solvents and Impurities

Abstract

2-(2’-Hydroxyphenyl)benzoxazole (HBO) is known for undergoing intramolecular proton transfer in the excited state to result in the emission of its tautomer. A minor long-wavelength absorption band in the range of 370-420 nm has been reported in highly polar solvents such as dimethylsulfoxide (DMSO). Yet the nature of this species has not been entirely clarified. In this work, we provide evidence that this long-wavelength absorption band might have been caused by base or metal salt impurities that are introduced into the spectral sample during solvent transport using glass Pasteur pipettes. The contamination by base or metal salt could be avoided by using borosilicate glass syringes or non-glass pipettes in sample handling. Quantum chemical calculations conclude that solvent-mediated deprotonation is too energetically costly to occur without the aid of a base of an adequate strength. In the presence of such a base, the deprotonation of HBO and its effect on emission are investigated in dichloromethane and DMSO, the latter of which facilitates deprotonation much more readily than the former. Finally, the absorption and emission spectra of HBO in 13 solvents are reported, from which it is concluded that ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 18 Nov 2014 | 10:39 am CET

Steric and Electronic Factors Associated with the Photoinduced Ligand Exchange of Bidentate Ligands Coordinated to Ru(II)

Abstract

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT), the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complexes 1 and 2 were compared to [Ru(bpy)2(dpb)](PF6)2 (3, bpy = 2,2′-bipyridine) and [Ru(biq)2(phen)](PF6)2 (4, phen = 1,10-phenanthroline). Distortions around the metal and biq ligands were used to explain the exchange of one biq ligand in 4 upon irradiation. Complex 1, however, undergoes photoinduced dissociation of the dpb ligand rather than biq under analogous experimental conditions. Complex 3 is not photoactive, providing evidence that the biq ligands are crucial for ligand photodissociation in 1. The crystal structures of 1 and 4 are compared to explain the difference in photochemistry between the complexes. Complex 2 absorbs lower energy light than 1, but is photochemically inert although its crystal structure displays significant distortions. These results indicate that both the excited state and electronic structure and steric bulk play key roles in bidentate photoinduced ligand dissociation. The present work also shows that it is possible to stabilize sterically hindered Ru(II) complexes by the addition of another metal, a property that may be useful for other applications.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 18 Nov 2014 | 10:31 am CET

Analysis of Oxyluciferin Photoluminescence Pathways in Aqueous Solutions

Abstract

We evaluated the pKa values of oxyluciferin and its conjugate acids and bases theoretically with the help of experimental correction values, from which free energies for the first excited and the ground states of all the species were estimated. On the basis of these results, we calculated pH-dependent absorption spectra, where the relative absorption intensities of various species strongly depend on photoexcitation energy, and we further analyzed the photoluminescence pathways of oxyluciferin in aqueous solutions with various pH. In the case of 350 nm photoexcitation, in particular, experiments have shown that dominant emission color is green and it attenuates with pH decreasing, while blue (3 < pH < 8) and red (pH < 3) emissions appear. Our present results clarify the pathways of these photoluminescence depending on the pH values and thus should be useful in further analyses of photoluminescence pathways for other photoexcitation wavelength in comparison with experiments.

Thumbnail image of graphical abstract

The pathways for photoluminescence of oxyluciferin, which is well known as the emitter of firefly bioluminescence, in aqueous solutions of different pH values were theoretically investigated by estimating free energies of possible species with consideration of protonation/deprotonation.

Quelle: Photochemistry and Photobiology | 17 Nov 2014 | 10:02 am CET

Editorial (2014, issue 6)

Quelle: Photochemistry and Photobiology | 14 Nov 2014 | 6:45 am CET

Reviewers for Photochemistry and Photobiology over the period October 1, 2013–October 1, 2014

Quelle: Photochemistry and Photobiology | 14 Nov 2014 | 6:45 am CET

A steady-state and time-resolved photophysical study of CdTe quantum dots in water

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00300D, Paper
Alessandro Iagatti, Luigi Tarpani, Eleonora Fiacchi, Laura Bussotti, Agnese Marcelli, Paolo Foggi, Loredana Latterini
The non-radiative electron-hole recombination processes are predominant in alkyl-thiol capped CdTe QDs prepared in water and they are affected by the nature of the capping agent.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 14 Nov 2014 | 1:00 am CET

Photosensitized oxidation of 9,10-dimethylanthracene with singlet oxygen by using a safranin O/silica composite under visible light

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00261J, Paper
Elim Albiter, Salvador Alfaro, Miguel A. Valenzuela
The photo-oxidation of DMA could be carried out in 3 steps: the first step is the photosensitized production of 1O2 near the surface of the composite; the second step is the diffusion of 1O2 from the surroundings of the surface to the solvent and the third step is the homogeneous reaction between 1O2 and DMA.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 14 Nov 2014 | 1:00 am CET

Opsin Expression in Human Epidermal Skin

Abstract

Human skin is constantly exposed to solar light containing visible and ultraviolet radiation (UVR), a powerful skin carcinogen. UVR elicits cellular responses in epidermal cells via several mechanisms: direct absorption of short-wavelength UVR photons by DNA, oxidative damage caused by long-wavelength UVR, and, as we recently demonstrated, via a retinal-dependent G protein-coupled signaling pathway. Because the human epidermis is exposed to a wide range of light wavelengths, we investigated whether opsins, light-activated receptors that mediate photoreception in the eye, are expressed in epidermal skin to potentially serve as photosensors. Here we show that four opsins—OPN1-SW, OPN2, OPN3 and OPN5—are expressed in the two major human epidermal cell types, melanocytes and keratinocytes, and the mRNA expression profile of these opsins does not change in response to physiological UVR doses. We detected two OPN3 splice variants present in similar amounts in both cell types and three OPN5 splice isoforms, two of which encode truncated proteins. Notably, OPN2 and OPN3 mRNA were significantly more abundant than other opsins and encoded full-length proteins. Our results demonstrate that opsins are expressed in epidermal skin cells and suggest that they might initiate light–induced signaling pathways, possibly contributing to UVR phototransduction.

Thumbnail image of graphical abstract

Human epidermal skin is exposed to a wide range of light wavelengths, raising the question whether it uses opsins, light-activated receptors that mediate photoreception in the eye, as photosensors. We found that the two major human epidermal cell types, melanocytes and keratinocytes, express mRNA for four opsins—OPN1-SW, OPN2, OPN3 and OPN5. OPN2 and OPN3 mRNA were significantly more abundant than other opsins and encoded full-length proteins. Future studies will determine the function of these opsins in melanocytes and keratinocytes.

Quelle: Photochemistry and Photobiology | 13 Nov 2014 | 9:53 am CET

Evidence of additional excitation energy transfer pathways in the phycobiliprotein antenna system of Acaryochloris marina

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00352G, Paper
A. C. Nganou, L. David, N. Adir, D. Pouhe, M. J. Deen, M. Mkandawire
To improve the energy conversion efficiency of solar organic cells, the clue may lie in the development of devices inspired by an efficient light harvesting mechanism of some aquatic photosynthetic microorganisms that are adapted to low light intensity.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 13 Nov 2014 | 1:00 am CET

Consequences of stratospheric ozone depletion and climate change on the use of materials

Photochem. Photobiol. Sci., 2015, 14,170-184
DOI: 10.1039/C4PP90038C, Perspective
A. L. Andrady, A. Torikai, H. H. Redhwi, K. K. Pandey, P. Gies
Materials used in the exterior of buildings and in construction are routinely exposed to solar UV radiation. Especially in the case of wood and plastic building materials, the service life is determined by their weather-induced deterioration.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Nov 2014 | 1:00 am CET

Tracking the primary photoconversion events in rhodopsins by ultrafast optical spectroscopy

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00370E, Perspective
D. Polli, I. Rivalta, A. Nenov, O. Weingart, M. Garavelli, G. Cerullo
We review the most recent experimental and computational efforts aimed at exposing the very early phases of the ultrafast isomerization in visual Rhodopsins and we discuss future advanced experiments and calculations.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Nov 2014 | 1:00 am CET

Effects of UV radiation on aquatic ecosystems and interactions with other environmental factors

Photochem. Photobiol. Sci., 2015, 14,108-126
DOI: 10.1039/C4PP90035A, Perspective
Donat-P. Hader, Craig E. Williamson, Sten-Ake Wangberg, Milla Rautio, Kevin C. Rose, Kunshan Gao, E. Walter Helbling, Rajeshwar P. Sinha, Robert Worrest
Combined effects of anthropogenic changes in the environmental condition in marine ecosystems, including UV, CO2 and temperature.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Nov 2014 | 1:00 am CET

Fast and effective inactivation of Bacillus atrophaeus endospores using light-activated derivatives of vitamin B2

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00285G, Paper
Anja Eichner, Anita Gollmer, Andreas Spath, Wolfgang Baumler, Johannes Regensburger, Burkhard Konig, Tim Maisch
The photodynamic approach is a procedure to inactivate Bacillus atrophaeus endospores in vitro and dried on food related surfaces. The flavin photosensitizers showed a fast and effective spore inactivation within 20 seconds.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 11 Nov 2014 | 1:00 am CET

N4-Methylation of Cytosine Drastically Favors the Formation of (6-4) Photoproducts in a TCG Context

Abstract

Methylation of cytosine is a common biological process both in prokaryotic and eukaryotic cells. In addition to 5-methylcytosine (5mC), some bacterial species contain in their genome N4-methylcytosine (N4mC). Methylation at C5 has been shown to enhance the formation of pyrimidine dimeric photoproducts but nothing is known of the effect of N4 methylation on UV-induced DNA damage. In the present work, we compared the yield and the nature of bipyrimidine photoproducts induced in a series of trinucleotides exhibiting a TXG sequence where X is either T, C, 5mC or N4mC. HPLC associated to tandem mass spectrometry was used to quantify cyclobutane pyrimidine dimers (CPD), (6-4) photoproducts (64PP) and their Dewar valence isomer. Methylation at position N4 was found to drastically increase the reactivity of C upon exposure to both UVC and UVB and to favor the formation of 64PP. In contrast methylation at C5 increased the yield of CPD at the expense of 64PP. In addition, enhancement of photoreactivity by C5 methylation was much higher in the UVB than in the UVC range. These results show the drastic effect of the methylation site on the photochemistry of cytosine.

Thumbnail image of graphical abstract

Methylation of cytosine at position C5 is known to favor the formation of UVB-induced cyclobutane pyrimidine dimers in DNA. We report here that methylation at another position, namely the N4 exocyclic amino group, enhances the photoreactivity of cytosine both in the UVB and UVC range, and drastically increases the formation of (6-4) photoproducts.

Quelle: Photochemistry and Photobiology | 10 Nov 2014 | 7:26 am CET

Solar UV Irradiances Modulate Effects of Ocean Acidification on the Coccolithophorid Emiliania huxleyi

Abstract

Emiliania huxleyi, the most abundant coccolithophorid in the oceans, is naturally exposed to solar UV radiation (UVR, 280–400 nm) in addition to photosynthetically active radiation (PAR). We investigated the physiological responses of E. huxleyi to the present day and elevated CO2 (390 vs 1000 μatm; with pHNBS 8.20 vs 7.86) under indoor constant PAR and fluctuating solar radiation with or without UVR. Enrichment of CO2 stimulated the production rate of particulate organic carbon (POC) under constant PAR, but led to unchanged POC production under incident fluctuating solar radiation. The production rates of particulate inorganic carbon (PIC) as well as PIC/POC ratios were reduced under the elevated CO2, ocean acidification (OA) condition, regardless of PAR levels, and the presence of UVR. However, moderate levels of UVR increased PIC production rates and PIC/POC ratios. OA treatment interacted with UVR to influence the alga's physiological performance, leading to reduced specific growth rate in the presence of UVA (315–400 nm) and decreased quantum yield, along with enhanced nonphotochemical quenching, with addition of UVB (280–315 nm). The results clearly indicate that UV radiation needs to be invoked as a key stressor when considering the impacts of ocean acidification on E. huxleyi.

Thumbnail image of graphical abstract

The coccolithophorid Emiliania huxleyi may be calcifying less with progressive ocean acidification (OA). However, little is known about the physiological responses of E. huxleyi to OA under the natural solar irradiances, including UV radiation (280–400 nm, UVR). We found UVR could modulate the effects of OA on growth, photosynthesis, and calcification of E. huxleyi. This work emphasizes that UVR needs to be considered as a key factor when evaluating the impacts of OA on E. huxleyi.

Quelle: Photochemistry and Photobiology | 10 Nov 2014 | 7:26 am CET

An essential role of NAD(P)H oxidase 2 in UVA-induced calcium oscillations in mast cells

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00304G, Paper
Zhi Ying Li, Wen Yi Jiang, Zong Jie Cui
UVA irradiation triggers calcium oscillations in mast cells, which are obliterated completely after siRNA down-regulation of NOX2 and its associated subunits, consistent with the fact that mast cells predominantly express NOX2.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Nov 2014 | 1:00 am CET

The consequences for human health of stratospheric ozone depletion in association with other environmental factors

Photochem. Photobiol. Sci., 2015, 14,53-87
DOI: 10.1039/C4PP90033B, Perspective
R. M. Lucas, M. Norval, R. E. Neale, A. R. Young, F. R. de Gruijl, Y. Takizawa, J. C. van der Leun
Ozone depletion, climate and human health.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Nov 2014 | 1:00 am CET

Photoisomerization and reorientational dynamics of DTDCI in AOT/alkane reverse micelles containing non-aqueous polar liquids

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00326H, Paper
Manika Dandapat, Debabrata Mandal
Torsional photoisomerization and rotational reorientation of carbocyanine fluorophore DTDCI were studied in AOT/alkane reverse micelles containing non-aqueous polar liquids DMF, formamide, ethylene glycol and glycerol, to probe microviscosity of the local environment.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Nov 2014 | 1:00 am CET

Triplet state quenching of phenosafranine dye by indolic compounds studied by transient absorption spectroscopy

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00365A, Paper
Martin F. Broglia, Carlos M. Previtali, Sonia G. Bertolotti
The interaction of the triplet state of the synthetic dye phenosafranine (3,7-diamino-5-phenylphenazinium chloride) with indolic compounds of biological relevance was investigated in water by means of laser flash photolysis.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Nov 2014 | 1:00 am CET

A caged substrate peptide for matrix metalloproteinases

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00297K, Paper
Elena Decaneto, Stefania Abbruzzetti, Inge Heise, Wolfgang Lubitz, Cristiano Viappiani, Markus Knipp
A caged substrate peptide for human MT1-MMP was synthesized and characterized. Photoactivation releases the peptide in a two-step mechanism for enzymatic hydrolysis.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Nov 2014 | 1:00 am CET

Oculocutaneous Albinism in Sub-Saharan Africa: Adverse Sun-Associated Health Effects and Photoprotection

Abstract

Oculocutaneous albinism (OCA) is a genetically inherited autosomal recessive condition. Individuals with OCA lack melanin and therefore are susceptible to the harmful effects of solar ultraviolet radiation, including extreme sun sensitivity, photophobia and skin cancer. OCA is a grave public health issue in sub-Saharan Africa with a prevalence as high as 1 in 1000 in some tribes. This article considers the characteristics and prevalence of OCA in sub-Saharan African countries. Sun-induced adverse health effects in the skin and eyes of OCA individuals are reviewed. Sun exposure behavior and the use of photoprotection for the skin and eyes are discussed to highlight the major challenges experienced by these at-risk individuals and how these might be best resolved.

Thumbnail image of graphical abstract

Oculocutaneous albinism (OCA) is a genetically inherited autosomal recessive condition. Individuals with OCA lack melanin and therefore are susceptible to the harmful effects of solar ultraviolet radiation, including extreme sun sensitivity, photophobia and skin cancer. OCA is a grave public health issue in sub-Saharan Africa with a prevalence as high as one in 1000 in some tribes. Given the extent of adverse sun-related health effects experienced among individuals with OCA, commitment to prevention and treatment regimens should be raised as a priority to curb the impact of OCA as a major health problem in sub-Saharan Africa.

Quelle: Photochemistry and Photobiology | 8 Nov 2014 | 6:15 am CET

UVA Irradiation Induced Heme Oxygenase-1: A Novel Phototherapy for Morphea

Abstract

Long wave UVA radiation (340–400 nm) causes detrimental as well as beneficial effects on human skin. Studies of human skin fibroblasts irradiated with UVA demonstrate increased expression of both antifibrotic heme oxygenase-1 (HO-1) and matrix metalloproteinase 1 (MMP-1). The use of UVA-induced MMP-1 is well-studied in treating skin fibrotic conditions such as localized scleroderma, now called morphea. However, the role that UVA-induced HO-1 plays in phototherapy of morphea has not been characterized. In the present manuscript, we have illustrated and reviewed the biological function of HO-1 and the use of UVA1 wavebands (340–400 nm) for phototherapy; the potential use of HO-1 induction in UVA therapy of morphea is also discussed.

Thumbnail image of graphical abstract

The possible mechanism of UVA1-induced antifibrotic HO-1 and MMP-1 expressions in UVA1 phototherapy of morphea. Regulation of HMOX-1 gene upon UVA irradiation in human skin cells to induce cytoprotection: UVA1-induced ROS activation of Nrf2 and release of Keap1 for ubiquitination, translocation of Nrf2 to the nucleus to switch on the ARE‘s to evoke HO-1 expression. UVA1 generated ROS lead to the MMP-1 expression directly via ERK, TNFα, IL-1, and IL-6, or indirectly through HO-1 expression. Both antifibrotic effects of MMP-1 and HO-1 may, through TGFβ1, rebuild the ECM.

Quelle: Photochemistry and Photobiology | 8 Nov 2014 | 6:15 am CET

Development of Effective Skin Cancer Treatment and Prevention in Xeroderma Pigmentosum

Abstract

Xeroderma pigmentosum (XP) is a rare, recessively transmitted genetic disease characterized by increasingly marked dyspigmentation and xerosis (dryness) of sun-exposed tissues, especially skin. Skin cancers characteristically develop in sun-exposed sites at very much earlier ages than in the general population; these are often multiple and hundreds or even thousands may develop. Eight complementation groups have been identified. Seven groups, XP-A…G, are associated with defective genes encoding proteins involved in the nucleotide excision DNA repair (NER) pathway that recognizes and excises mutagenic changes induced in DNA by sunlight, the eighth group, XP-V, is associated with defective trans-lesion synthesis (TLS) bypassing such alterations. The dyspigmentation, xerosis, and eventually carcinogenesis in XP patients appear to be due to their cells’ failure to respond properly to these mutagenic DNA alterations, leading to mutations in skin cells. A subset of cases, especially those in some complementation groups, may develop neurological degeneration, which may be severe. However, in most XP patients in the past the multiple skin cancers have led to death at an early age due either to metastases or sepsis. Using either topical 5-fluorouracil or imiquimod, we have developed a protocol that effectively prevents most skin cancer development in XP patients.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 4:23 pm CET

Comparison of Templating Abilities of Urea and Thioruea During Photodimerization of Bipyridylethyelene and Stilbazole Crystals

Abstract

Photodimerization of cocrystals of four bispyridylethylenes and two stilbazoles with urea as a template in the solid state has been investigated following our success with thiourea. Four investigated olefins photodimerized quantitatively to a single dimer in the crystalline state only. The reactivity of urea–olefin crystals is understood on the basis of their packing arrangements in the crystalline state. In reactive crystals the adjacent reactive molecules are within 4.2 Å and parallel, whereas the unreactive ones have their adjacent molecules are farther than 4.6Å and nonparallel. Thus, with the knowledge of crystal packing the reactivity of urea–olefin crystals is predictable on the basis of Schmidt's topochemical postulates. The templating property of urea, similar to thiourea, derives from its ability to form hydrogen bonds with itself and the guest olefins. Despite the similarities in molecular structures of urea and thiourea their subtle electronic properties, yet to be fully understood, affect the crystal packing and consequently their reactivity in the crystalline state. Further work is needed to fully exploit the templating properties of urea.

Thumbnail image of graphical abstract

Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 2:22 pm CET

MC1R, Eumelanin and Pheomelanin: Their Role in Determining the Susceptibility to Skin Cancer

Abstract

Skin pigmentation is due to the accumulation of two types of melanin granules in the keratinocytes. Besides being the most potent blocker of ultraviolet radiation, the role of melanin in photoprotection is complex. This is because one type of melanin called eumelanin is UV absorbent, whereas the other, pheomelanin, is photounstable and may even promote carcinogenesis. Skin hyperpigmentation may be caused by stress or exposure to sunlight, which stimulates the release of α-melanocyte stimulating hormone (α-MSH) from damaged keratinocytes. Melanocortin 1 receptor (MC1R) is a key signaling molecule on melanocytes that responds to α-MSH by inducing expression of enzymes responsible for eumelanin synthesis. Persons with red hair have mutations in the MC1R causing its inactivation; this leads to a paucity of eumelanin production and makes red-heads more susceptible to skin cancer. Apart from its effects on melanin production, the α-MSH/MC1R signaling is also a potent anti-inflammatory pathway and has been shown to promote antimelanoma immunity. This review will focus on the role of MC1R in terms of its regulation of melanogenesis and influence on the immune system with respect to skin cancer susceptibility.

Thumbnail image of graphical abstract

Animal models indicate that the presence of pheomelanin is a required component for elaborating the increased melanoma risk in MCR1mutant mouse strains. This review examines the properties of pheomelanin and eumelanin with respect to the generation of toxic byproducts, depletion of scavenger pools, photoinstability and poor UVR absorption properties. Furthermore, a new understanding of MC1R function in cells of innate and adaptive immunity, suggests that the mutant receptor also causes altered responses, in terms of high inflammatory responses, contributing toward increasing the risk of melanoma development in light or red-headed individuals.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 2:17 pm CET

Ozone depletion and climate change: impacts on UV radiation

Photochem. Photobiol. Sci., 2015, 14,19-52
DOI: 10.1039/C4PP90032D, Perspective
A. F. Bais, R. L. McKenzie, G. Bernhard, P. J. Aucamp, M. Ilyas, S. Madronich, K. Tourpali
Percentage changes in the UV Index (UVI) for 2090 relative to 2015 due to changes in ozone (left) and aerosols (right) only. Large decreases are projected over Antarctica due to stratospheric ozone recovery. Increases are projected for parts of Asia due to decreases in aerosols, partly reversing the possible large reductions in UVI after the 1950s.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 Nov 2014 | 1:00 am CET

Changes in air quality and tropospheric composition due to depletion of stratospheric ozone and interactions with changing climate: implications for human and environmental health

Photochem. Photobiol. Sci., 2015, 14,149-169
DOI: 10.1039/C4PP90037E, Perspective
S. Madronich, M. Shao, S. R. Wilson, K. R. Solomon, J. D. Longstreth, X. Y. Tang
UV radiation is an essential driver for the formation of photochemical smog, which includes ground-level ozone and particulate matter (PM).
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 Nov 2014 | 1:00 am CET

Effects of stratospheric ozone depletion, solar UV radiation, and climate change on biogeochemical cycling: interactions and feedbacks

Photochem. Photobiol. Sci., 2015, 14,127-148
DOI: 10.1039/C4PP90036G, Perspective
David J. Erickson III, Barbara Sulzberger, Richard G. Zepp, Amy T. Austin
Solar UV radiation and climate change interact to influence and determine the environmental conditions for humans on planet Earth.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 Nov 2014 | 1:00 am CET

Simplified reaction kinetics, models and experiments for glyphosate degradation in water by the UV/H2O2 process

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00248B, Paper
Eduardo Vidal, Antonio Negro, Alberto Cassano, Cristina Zalazar
This work reports the degradation kinetics of glyphosate in water employing the UV/H2O2 process. The kinetic model was experimentally validated. Results compare the kinetics of the herbicide alone and a commercial formulation.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 6 Nov 2014 | 1:00 am CET

Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins

Abstract

The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's ketone linkers have been investigated by means of steady state and time-resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well-stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases.

Thumbnail image of graphical abstract

The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

Quelle: Photochemistry and Photobiology | 31 Oct 2014 | 5:46 am CET

The Effects of NO3− Supply on Mazzaella laminarioides (Rhodophyta, Gigartinales) from Southern Chile

Abstract

The effects of nitrate supply on growth, pigments, mycosporine-like amino acids (MAAs), C:N ratios and carrageenan yield were investigated in Mazzaella laminarioides cultivated under solar radiation. This species is economically important in southern Chile where an increase of nitrogen in coastal waters is expected as a consequence of salmon aquaculture activity. Apical segments were cultivated in enriched seawater with five different inline image concentrations (0, 0.09, 0.18, 0.38 and 0.75 mm) during 18 days. Although phycoerythrin and phycocyanin content, as well as C:N ratios, were reduced in the control treatment (without inline image supply), when compared to inline image treatments, total MAA concentration, carrageenan yield and growth rates were similar in all tested conditions. Nevertheless, during the experiment, an important synthesis of mycosporine-glycine took place in a nitrate concentration-dependent manner, with accumulation being saturated around 0.18 mm of nitrate. These results indicate that exposure to high inline image concentration of more than 100 times the values observed in the nature did not impair the photoprotection system, as determined by MAAs, nor did it have a deleterious effect on growth or carrageenan yield of M. laminarioides, a late successional species from Chile.

Thumbnail image of graphical abstract

The effect of inline image on Mazzaella laminarioides was evident by the preferential accumulation of mycosporine-glycine, rather than total MAAs. The fact that mycosporine-glycine, but not total MAAs, was increased could have resulted from interconversions among different MAAs. Synthesis and accumulation of compounds with antioxidant activities, such as mycosporine-glycine, could play an important ecological role.

Quelle: Photochemistry and Photobiology | 30 Oct 2014 | 6:24 am CET

Development of Refractoriness of HO-1 Induction to a Second Treatment with UVA Radiation and the Involvement of Nrf2 in Human Skin Fibroblasts

Abstract

UVA treatment of cultured human skin fibroblasts (FEK4) has been shown previously to reduce transcriptional activation of heme oxygenase 1 (HO-1) following a second dose of UVA radiation, a phenomenon known as refractoriness. This study demonstrates that the levels of HO-1 protein are also reduced after a second dose of UVA radiation as are Nrf2 levels, and there is less accumulation of Nrf2 in the nucleus where as Bach1 does accumulate in the nucleus. Cell viability is further reduced and cell membrane damage increased as compared with a single UVA treatment when an initial UVA treatment was followed by a second dose. Knockdown of Nrf2 by siRNA (siNrf2) targeting caused additional refractoriness of HO-1 protein induction to a second UVA or heme treatment and this treatment also further enhanced cell damage by a second dose of UVA radiation. However, transfection with Nrf2 caused less refractoriness of HO-1 to a second dose of UVA and reduced cell damage by a second dose of UVA radiation. These findings are consistent with the proposal that Nrf2 is involved in HO-1 refractoriness and could serve as a cytoprotective factor against cell damage caused by repeated exposure to moderate doses of UVA radiation. We propose that protection by the Nrf2-HO-1 pathway protection may have clinical relevance since human skin is exposed repeatedly to UVA radiation.

Thumbnail image of graphical abstract

HO-1 refractoriness following a second dose of UVA irradiation: Lack of heme and lack of de novo Nrf2 activation will contribute to the development of refractoriness of the HO-1 protein to reinduction by a challenge dose of UVA. Low basal (A) and high level of HO-1 protein induction following UVA (B); HO-1 refractoriness of UVA/UVA (C).

Quelle: Photochemistry and Photobiology | 27 Oct 2014 | 7:26 am CET

Photostability of Cosmetic UV Filters on Mammalian Skin Under UV Exposure

Abstract

Previous studies showed that the common UV filter substances benzophenone-3 (BP–3), butyl methoxydibenzoylmethane (BM–DBM), octocrylene (OCR), ethylhexyl methoxycinnamate (EHMC), ethylhexyl salicylate (EHS) and ethylhexyl triazone (EHT) were able to react with amino side chains of different proteins in vitro. To transfer the results to mammalian skin conditions, sunscreen products were applied on both prepared fresh porcine skin and glass plates, followed by UV irradiation and the determination of depletion of the respective UV filters. Significantly lower recoveries of the UV filters extracted from skin samples than from glass plates indicated the additional reaction of the UV filters with skin constituents, when proteins will be the most important reactants. Among the products tested, BP-3 showed the greatest differences in recoveries between glass and skin samples of about 13% and 24% after 2 and 4 h of irradiation, respectively, followed by EHS > BM-DBM > OCR > EHMC > EHT. The obtained results raise the question, whether the common in vitro evaluations of sunscreens, using inert substrate materials like roughened quartz or polymethyl methacrylate (PMMA) plates are really suitable to fully replace in vivo methods, as they cannot include skin-typical reactions.

Thumbnail image of graphical abstract

Previous studies showed that common UV filter substances like BP-3, BM-DBM, EHS, OCR, EHMC and EHT were able to react with amino side chains of different proteins in vitro. The present work confirms that also in the case of real skin samples, differences in the recoveries could be observed when sunscreen samples were irradiated on either glass plates or pig skin, indicating the occurrence of certain skin-typical reactions, as the formation of protein adducts. The results were in good accordance with a recently developed HPTLC screening method, indicating a different photocontact allergenic potential of the UV filters.

Quelle: Photochemistry and Photobiology | 25 Oct 2014 | 9:40 am CEST

Specific Features of Early Stage of the Wound Healing Process Occurring Against the Background of Photodynamic Therapy Using Fotoditazin Photosensitizer–Amphiphilic Polymer Complexes

Abstract

There is a growing demand on the studies of the wound healing potentials of photodynamic therapy. Here we analyze the effects of Fotoditazin, an e6 chlorine derivative, and its complexes with amphiphilic polymers, on the early stage of wound healing in a rat model. A skin excision wound model with prevented contraction was developed in male albino rats divided into eight groups according to the treatment mode. All animals received injections of one of the studied compositions into their wound beds and underwent low-intensity laser irradiation or stayed un-irradiated. The clinical monitoring and histological examination of the wounds were performed. It has been found that all the Fotoditazin formulations have significant effects on the early stage of wound healing. The superposition of the inflammation and regeneration was the main difference between groups. The aqueous solution of Fotoditazin alone induced a significant capillary hemorrhage, while its combinations with amphiphilic polymers did not. The best clinical and morphological results were obtained for the Fotoditazin–Pluronic F127 composition. Compositions of Fotoditazin and amphiphilic polymers, especially Pluronic F127, probably, have a great potential for therapy of wounds. Their effects can be attributed to the increased regeneration and suppressed reactions changes at the early stages of repair.

Thumbnail image of graphical abstract

Here we analyze the effects of Fotoditazin, a e6 chlorine derivative, and its complexes with amphiphilic polymers, on the early stage of wound healing in a rat model. In this hematoxylin–eosin stained tissue (magnification ×200) one can see the difference between an untreated wound (1) with a thick fibrinous-leucocytic layer and immature granulation tissue, and a wound treated with the Fotoditazin–Pluronic 127 complex (2), showing relatively mature granulation tissue with vertical capillaries. Compositions of Fotoditazin and amphiphilic polymers, especially Pluronic F127, probably have a great potential for therapy of wounds.

Quelle: Photochemistry and Photobiology | 20 Oct 2014 | 1:24 pm CEST

Highly Efficient Photodegradation of Organic Pollutants Assisted by Sonoluminescence

Abstract

The mechanism of the photodegradation of azo dyes via ultrasonication is studied using a combination of the high-performance liquid chromatography and UV–vis spectroscopy with detailed analysis of the kinetics. Based on the kinetics studies of the sonodegradation, it was proposed that the degradation of azo dyes was a multistage process that involved: (1) the direct attack of azo bonds and phenyl rings of dyes by the sonochemically formed reactive oxygen species; (2) the activation of semiconductor particles by the light emitted during cavitation and the triggering of the photocatalytic pathways of dye degradation and (3) increase of the adsorption capacity of the semiconductor particles due to the sonomechanically induced interparticle collisions. The detailed kinetics study can help in following an effective process up-scaling. It was demonstrated that extremely short pulses of light flashes in a cavitated mixture activated the surface of photocatalysts and significantly enhanced dye degradation processes.

Thumbnail image of graphical abstract

The kinetics of dye degradation via ultrasonication was studied. It was shown that Light emitted in cavitated liquid was essential for initiation of the photoreactions on the surface of the semiconductor particles. Direct attack of dye molecules by sonochemically formed reactive oxygen species causes relatively slow degradation of azo dyes. The mechanism of ultrasound-assisted degradation of azo dyes is mostly based on the activation of photocatalysts by sonoluminescence.

Quelle: Photochemistry and Photobiology | 20 Oct 2014 | 12:55 pm CEST

Cellular Changes Associated with the Acclimation of the Intertidal Sea Anemone Actinia tenebrosa to Ultraviolet Radiation

Abstract

To assess the relative importance of long- and short-term cellular defense mechanisms in seasonally UV-R-acclimated Actinia tenebrosa (Anthozoa, Actiniidae), individuals were exposed to summer doses of PAR, UV-A, UV-B and enhanced UV-B (20%) for a period of 4 days. Mycosporine-like amino acids (MAAs) and cyclobutane pyrimidine dimer (CPD) concentrations were quantified, while oxidative damage to lipids and proteins, and the activities or levels of the antioxidant enzymes SOD, CAT, GR, GPOX and total glutathione were determined. Our results show that summer UV-R-acclimated individuals had a higher UV-R tolerance, with no significant increases in CPDs levels, than winter-acclimated sea anemones possibly due to higher MAA concentrations. Summer-acclimated individuals showed increased lipid and protein oxidation and GPOX activity only when they were exposed to UV-B at 20% above ambient UV-R levels. In contrast, winter-acclimated sea anemones showed elevated levels of oxidative damage, GPOX and SOD activities after exposure to UV-A or UV-B at ambient and elevated levels. Thus, this study indicates that long-term UV-R acclimation mechanisms such as the accumulation of MAAs could be more important than short-term increases in antioxidant defenses with respect to reducing indirect UV-R damage in intertidal sea anemones.

Thumbnail image of graphical abstract

Cyclobutane pyrimidine dimers (CPDs) levels in summer (A) and winter (B) UV-B-acclimated Actinia tenebrosa exposed to four radiation treatments (P [PAR], PA [PAR + UVA], PAB [PAR + UVA + UVB] and PAB-20% [PAR + UVA + UVB-20%]). Animals sampled in summer, exposed to artificially enhanced levels of UV-B and allowed to recover following exposure, showed no accumulation of CPDs over a 4-day experimental period. In contrast, organisms sampled in winter accumulated CPDs in a dose-dependent manner.

Quelle: Photochemistry and Photobiology | 18 Oct 2014 | 12:18 pm CEST

Inspection of Feasible Calibration Conditions for UV Radiometer Detectors with the KI/KIO3 Actinometer

Abstract

UV radiometers are widely employed for irradiance measurements, but their periodical calibrations not only induce an extra cost but also are time-consuming. In this study, the KI/KIO3 actinometer was applied to calibrate UV radiometer detectors at 254 nm with a quasi-collimated beam apparatus equipped with a low-pressure UV lamp, and feasible calibration conditions were identified. Results indicate that a washer constraining the UV light was indispensable, while the size (10 or 50 mL) of a beaker containing the actinometer solution had little influence when a proper washer was used. The absorption or reflection of UV light by the internal beaker wall led to an underestimation or overestimation of the irradiance determined by the KI/KIO3 actinometer, respectively. The proper range of the washer internal diameter could be obtained via mathematical analysis. A radiometer with a longer service time showed a greater calibration factor. To minimize the interference from the inner wall reflection of the collimating tube, calibrations should be conducted at positions far enough away from the tube bottom. This study demonstrates that after the feasible calibration conditions are identified, the KI/KIO3 actinometer can be applied readily to calibrate UV radiometer detectors at 254 nm.

Thumbnail image of graphical abstract

Under feasible calibration conditions, the KI/KIO3 actinometer can be easily applied to calibrate UV radiometer detectors at 254 nm in a quasi-collimated beam apparatus in ordinary laboratories, which saves the cost and time for periodic detector recalibrations.

Quelle: Photochemistry and Photobiology | 18 Oct 2014 | 12:18 pm CEST

Photoactive Chitosan: A Step Toward a Green Strategy for Pollutant Degradation

Abstract

This article is a highlight of the paper by Ferrari et al. in this issue of Photochemistry and Photobiology. It describes the innovative use of rose bengal-conjugated chitosan as a reusable green catalyst that photo-degrades phenolic compounds in aqueous media, and thereby has decontamination potential of polluted waters. Whether a next-generation photoactive polymer that produces singlet oxygen is a solution to pollutant degradation can be argued. It is as yet unclear what polymeric sensitizer would be practical on a large scale. Nonetheless pursuing this goal is worthwhile.

Thumbnail image of graphical abstract

This article highlights the work of Ferrari et al. who describe the use of rose bengal-chitosan conjugate as a reusable green photosensitizer that degrades phenolic compounds in aqueous media.

Quelle: Photochemistry and Photobiology | 16 Oct 2014 | 11:32 am CEST

Skin Responses to Micro Scale Field Size of Solar-Simulated Radiation – Preliminary Evaluation by Reflectance Confocal Microscopy in vivo

Abstract

Erythema and pigment responses of human skin following an acute exposure to ultraviolet radiation (UVR) are frequently used to determine the photosensitivity of the skin. In this study we investigated the responses of the skin to a micro-scale area of UVR exposure (MiR) and compared the responses to a macro-scale area of exposure (MaR). Ten human volunteers were tested with solar-simulated radiation on their upper arm or back using a beam size of 8 mm and 0.2 mm in diameter. The fluence required to produce a minimally perceptible erythema (MED) using the MiR was found to be higher than that for the MaR. The erythema response extended beyond the exposed area and this became pronounced when the beam size was microscopic. Reflectance confocal microscopy in vivo revealed that MiR induced cellular alterations within a confined area of smaller dimensions than the area of exposure. Pigment responses were confined within the areas of cellular damage. The erythema expression of exposed skin recovered faster for the sites receiving MiR even when the applied fluence was higher than the MED for the MaR. Through the use of MiR we were able to visualize spatially dissimilar skin responses of erythema and pigmentation suggesting different cellular mechanisms.

Thumbnail image of graphical abstract

We investigated the link between the areas of exposure from solar-simulated radiation and that of cellular changes, delayed erythema and pigmentation, and to determine if a microscopic skin site might be used when photo testing is necessary in clinical studies of photodermatoses or in testing for protection by various modalities. Through the use of micro scale beam size for radiation we were able to visualize spatially dissimilar skin responses of delayed erythema and pigmentation suggesting different cellular mechanisms.

Quelle: Photochemistry and Photobiology | 15 Oct 2014 | 1:37 pm CEST

The Employment of a Removable Chitosan-Derivatized Polymeric Sensitizer in the Photooxidation of Polyhydroxylated Water-Pollutants

Abstract

The known O2(1g)-sensitizer system Chitosan bounded Rose Bengal (CH-RB), with Rose Bengal (RB) immobilized by irreversible covalent bonding to the polymer Chitosan (CH), soluble in aquous acidic medium, was employed in the photodegradation of three tri-hydroxy benzene water-contaminants (THBs). The system sensitizes the O2(1g)-mediated photodegradation of THBs by a process kinetically favored, as compared to that employing free RB dissolved in the same solvent. Additionally the free xanthene dye, degradable by O2(1g) through self-sensitization upon prolonged light-exposure, is considerably protected when bonded to CH-polymer. The polymeric sensitizer, totally insoluble in neutral medium, can be removed from the solution after the photodegradative cycle by precipitation through a simple pH change. This fact constitutes an interesting aspect in the context of photoremediation of confined polluted waters. In other words, the sensitizing system could be useful for avoiding to dissolve dyestuffs in the polluted waters, in order to act as conventional sunlight-absorbing dye-sensitizers. In parallel the interaction CH - O2(1g) in acidic solution was evaluated. The polymer quenches the oxidative species with a rate constant 2.4 × 108 M−1 s−1 being the process mostly attributable to a physical interaction. This fact promotes the photoprotection of the bonded dye in the CH-RB polymer.

Thumbnail image of graphical abstract

The known O2(1g)-sensitizer system Chitosan-bounded-Rose Bengal (CH-RB), with the dye immobilized by irreversible covalent bonding to the polymer Chitosan (CH), soluble in aqueous acidic medium, was employed in the photodegradation of tri-hydroxy benzene water-contaminants (THBs). The system sensitizes the O2(1g)-mediated photodegradation of THBs. The polymeric sensitizer, totally insoluble in neutral medium, can be removed from the solution after the photodegradative cycle by precipitation through a simple pH change.

Quelle: Photochemistry and Photobiology | 13 Oct 2014 | 1:18 pm CEST

Interleukin-17 Mediated Inflammatory Responses Are Required for Ultraviolet Radiation-Induced Immune Suppression

Abstract

Ultraviolet radiation (UVR) induces immunosuppression and is a major factor for development of skin cancer. Numerous efforts have been made to determine mechanisms for UVR-induced immunosuppression and to develop strategies for prevention and treatment of UVR-induced cancers. In the current study, we use IL-17 receptor (IL-17R) deficient mice to examine whether IL-17 mediated responses have a role in UVB (290–320)-induced immunosuppression of contact hypersensitivity responses. Results demonstrate that IL-17 mediated responses are required for UVB-induced immunosuppression of contact hypersensitivity responses. The systemic immune suppression and development of regulatory T cells are inhibited in UVB-treated IL-17R deficient mice compared to wild-type animals. The deficiency in IL-17R inhibits the infiltration and development of a tolerogenic myeloid cell population in UVB-treated skin, which expresses CD11b and Gr-1 and produces reactive oxygen species. We speculate that the development of the tolerogenic myeloid cells is dependent on IL-17-induced chemokines and inflammatory mediators in UVB-treated skin. The inhibition of the tolerogenic myeloid cells may be attributed to the suppression of regulatory T cells in UVR-treated IL-17R−/− mice. The findings may be exploited to new strategies for prevention and treatment of UVR-induced skin diseases and cancers.

Thumbnail image of graphical abstract

Ultraviolet radiation (UVR) causes immune suppression which is associated with an increased risk of skin cancers. Exposure to UVR induces inflammation with an increased level of interleukin-17 in the skin. Our data show that blockade of interleukin-17 inhibits UVR-induced immune suppression. The lack of interleukin-17-mediated inflammation reduces the infiltration and development of suppressive myeloid cells in the ultraviolet-irradiated skin and development of regulatory T cells. The results implicate that interleukin-17 is an important mediator for UVR-induced immune suppression and may be a target for development of new strategies for the prevention of UVR-induced skin cancers.

Quelle: Photochemistry and Photobiology | 13 Oct 2014 | 1:18 pm CEST

Sun Exposure and Vitamin D Status as Northeast Asian Migrants Become Acculturated to Life in Australia

Abstract

Vitamin D deficiency is more common in Northeast-Asian immigrants to western countries than in the local population; prevalence equalizes as immigrants adopt the host country's culture. In a community-based study of 100 Northeast-Asian immigrants in Canberra, Australia, we examined predictors of vitamin D status, its association with indicators of acculturation (English language use; time since migration) and mediators of that association. Participants completed a sun and physical activity diary and wore an electronic ultraviolet radiation (UVR) dosimeter for 7 days. Skin colour was measured by reflectance spectrophotometry. Serum concentrations of 25-hydroxyvitamin D (25(OH)D) and cardio-metabolic biomarkers were measured on fasting blood. In a multiple linear regression model, predictors for 25(OH)D concentration were season of blood collection, vitamin D supplementation, UVR exposure, body mass index, physical activity and having private health insurance (R2 = 0.57). Greater acculturation was associated with lower risk of vitamin D deficiency (de-seasonalized 25(OH)D level <50 nmol L−1) (Adjusted Odds Ratio (AOR): 0.22 [95%CI 0.04–0.96]); this association was statistically mediated by physical activity and time outdoors. Vitamin D deficiency was associated with higher total cholesterol levels (>5.0 mmol L−1) (AOR: 7.48 [95%CI 1.51–37.0]). Targeted public health approaches are required to manage the high prevalence of vitamin D deficiency in migrants retaining a traditional lifestyle.

Thumbnail image of graphical abstract

In this community-based study of 100 Northeast-Asian immigrants in Canberra, Australia, we examined predictors of vitamin D status, its association with indicators of acculturation (English language use; time since migration) and mediators of that association. In a multiple linear regression model, predictors for 25(OH)D concentration were season of blood collection, vitamin D supplementation, UVR exposure, body mass index, physical activity and having private health insurance. Greater acculturation was associated with lower risk of vitamin D deficiency (de-seasonalized 25(OH)D level <50 nmol L−1); this association was statistically mediated by physical activity and time outdoors. Vitamin D deficiency was associated with higher total cholesterol levels. This figure shows that the odds of having higher cholesterol decrease with higher 25(OH)D levels.

Quelle: Photochemistry and Photobiology | 13 Oct 2014 | 9:41 am CEST

Improving Photoprotection Attitudes in the Tropics: Sunburn vs Vitamin D

Abstract

The ultraviolet radiation of type B (the UVB) stimulates both the production of vitamin D (VD) and the incorporation of erythema dose (ED). The UVA also contributes to ED. The turning point between the benefit of producing VD and the harm of incorporating ED cannot be determined easily. However, the casual behavior regarding the exposure to the Sun can be changed in order to improve the protoprotection attitudes and create a trend towards benefit. In the case, people living in the low latitudes should exposure themselves to the Sun for a determined time interval within the noon time and avoid the Sun in other periods. This would produce an adequate amount of VD through the VD dose (207–214 J m−2) against minimum ED (≈105 J m−2) for skin type II. For it, unprotected forearms and hands must be exposed to the noon Sun (cloudless) for 11 min (winter) and 5 min (summer). The exposure at other times different from noon can represent increases of up to 24% in ED and up to 12 times in the time interval to be in the Sun in relation to the minimum amounts of both ED and time interval at noon.

Thumbnail image of graphical abstract

Time in the Sun for adequate Standard Vitamin D dose (SDD) in the Tropics for cloudless days in the winter and summer. The annual average SDD is 210 J m−2.

Quelle: Photochemistry and Photobiology | 13 Oct 2014 | 9:40 am CEST

Fisetin Inhibits UVB-induced Cutaneous Inflammation and Activation of PI3K/AKT/NFκB Signaling Pathways in SKH-1 Hairless Mice

Abstract

Solar ultraviolet B (UVB) radiation has been shown to induce inflammation, DNA damage, p53 mutations and alterations in signaling pathways eventually leading to skin cancer. In this study, we investigated whether fisetin reduces inflammatory responses and modulates PI3K/AKT/NFκB cell survival signaling pathways in UVB-exposed SKH-1 hairless mouse skin. Mice were exposed to 180 mJ cm−2 of UVB radiation on alternate days for a total of seven exposures, and fisetin (250 and 500 nmol) was applied topically after 15 min of each UVB exposure. Fisetin treatment to UVB-exposed mice resulted in decreased hyperplasia and reduced infiltration of inflammatory cells. Fisetin treatment also reduced inflammatory mediators such as COX-2, PGE2 as well as its receptors (EP1–EP4) and MPO activity. Furthermore, fisetin reduced the level of inflammatory cytokines TNFα, IL-1β and IL-6 in UVB-exposed skin. Fisetin treatment also reduced cell proliferation markers as well as DNA damage as evidenced by increased expression of p53 and p21 proteins. Further studies revealed that fisetin inhibited UVB-induced expression of PI3K, phosphorylation of AKT and activation of the NFκB signaling pathway in mouse skin. Overall, these data suggest that fisetin may be useful against UVB-induced cutaneous inflammation and DNA damage.

Thumbnail image of graphical abstract

Exposure to solar UVB radiation has been implicated as the main cause for skin cancer. In this study, we investigated whether fisetin, a flavonoid abundantly present in fruits and vegetables, reduces inflammatory responses and modulates PI3K/AKT/NFκB cell survival signaling pathways in UVB-exposed SKH-1 hairless mouse skin. Our data demonstrated that topical application of fisetin to SKH-1 mice inhibited UVB-induced inflammation and proliferation by modulating PI3K/AKT/NFκB signaling pathways. In addition, fisetin treatment augmented UVB-induced protein expression of p53 and p21 as well as reduced DNA damage caused by UVB exposure. Overall, these findings suggest that fisetin could be developed as a novel photochemopreventive agent.

Quelle: Photochemistry and Photobiology | 7 Oct 2014 | 1:24 pm CEST

Antitumor Effect of Sinoporphyrin Sodium-Mediated Photodynamic Therapy on Human Esophageal Cancer Eca-109 Cells

Abstract

The aim of this study was to evaluate the photodynamic effect of Sinoporphyrin sodium (DVDMS). In this study, Eca-109 cells were treated with DVDMS (5 μg mL−1) and subjected to photodynamic therapy (PDT). The uptake and subcellular localization of DVDMS were monitored by flow cytometry and confocal microscopy. The phototoxicity of DVDMS was studied by MTT assay. The morphological changes were observed by scanning electron microscopy (SEM). DNA damage, reactive oxygen species (ROS) generation and mitochondria membrane potential (MMP) changes were analyzed by flow cytometry. Studies demonstrated maximal uptake of DVDMS occurred within 3 h, with a mitochondrial subcellular localization. MTT assays displayed that DVDMS could be effectively activated by light and the phototoxicity was much higher than photofrin under the same conditions. In addition, SEM observation indicated that cells were seriously damaged after PDT treatment. Furthermore, activation of DVDMS resulted in significant increases in ROS production. The generated ROS played an important role in the phototoxicity of DVDMS. DVDMS-mediated PDT (DVDMS-PDT) also induced DNA damage and MMP loss. It is demonstrated that DVDMS-mediated PDT is an effective approach on cell proliferation inhibition of Eca-109 cells.

Thumbnail image of graphical abstract

The chemical structure of DVDMS.

Quelle: Photochemistry and Photobiology | 7 Oct 2014 | 1:24 pm CEST

Design of a Gd-DOTA-Phthalocyanine Conjugate Combining MRI Contrast Imaging and Photosensitization Properties as a Potential Molecular Theranostic

Abstract

The design and synthesis of a phthalocyanine – Gd-DOTA conjugate is presented to open the way to novel molecular theranostics, combining the properties of MRI contrast imaging with photodynamic therapy. The rational design of the conjugate integrates isomeric purity of the phthalocyanine core substitution, suitable biocompatibility with the use of polyoxo water-solubilizing substituents, and a convergent synthetic strategy ended by the use of click chemistry to graft the Gd-DOTA moiety to the phthalocyanine. Photophysical and photochemical properties, contrast imaging experiments and preliminary in vitro investigations proved that such a combination is relevant and lead to a new type of potential theranostic agent.

Thumbnail image of graphical abstract

A Gd-DOTA-phthalocyanine conjugate designed to combine MRI contrast imaging and photosensitization properties as a potential molecular theranostic has been prepared. The singlet oxygen generation ability of the phthalocyanine core is retained. Relaxivity of the complex is suitable for imaging purposes. The conjugate is well internalized in MCF-7 cells.

Quelle: Photochemistry and Photobiology | 7 Oct 2014 | 1:24 pm CEST

Photo-Wolff Rearrangement of 2-Diazo-1,2-naphthoquinone: Stern–Volmer Analysis of the Stepwise Reaction Pathway

Abstract

2-Diazo-1,2-naphthoquinone (1) and its derivatives are the photoactive components in Novolak photoresists. A femtosecond infrared study has established that the photoreaction of 1 proceeds largely by a concerted Wolff rearrangement yielding the ketene 1H-inden-1-ylidene-methanone (3) within 300 fs after excitation, but earlier trapping studies gave evidence for a minor reaction path via a carbene intermediate 1-oxo-2(1H)-naphthalenylidene (2) with a lifetime of about 10 ps. Here, we provide a quantitative assessment of the stepwise pathway by Stern–Volmer analysis of the trapping of 2 by methanol to yield 2-methoxy-1-naphthol (4). We conclude that the lifetime of the carbene 2 is at least 200 ps. Moreover, [3 + 2]cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was observed. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Thumbnail image of graphical abstract

A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Quelle: Photochemistry and Photobiology | 30 Sep 2014 | 12:24 pm CEST

Photocatalysis of Chloroform Decomposition by Tetrachlorocuprate (II) on Dowex 2-X8

Abstract

Heterogenized on a polystyrene anion exchange resin and in the presence of oxygen, inline image catalyzes the photodecomposition of chloroform at wavelengths above 345 nm with greater efficiency than an equivalent amount in homogeneous solution. The reaction is proposed to proceed in two stages, the first stage yielding CCl4 and inline image as products, the second consisting of a chain reaction resulting from the inline image-catalyzed photodissociation of CCl4, yielding phosgene with CCl3 radicals as chain carriers. Photodecomposition is retarded by added Cl, CH3CN, C6H12 or C2H5OH, which is ascribed to the displacement of CHCl3 molecules from the vicinity of the copper by attraction to the polystyrene matrix or to the alkylammonium cation sites.

Thumbnail image of graphical abstract

In the presence of CuCl42- heterogenized on a Dowex anion exchange resin, chloroform is decomposed under irradiation at wavelengths above 345 nm.

Quelle: Photochemistry and Photobiology | 25 Sep 2014 | 12:39 pm CEST

Photocatalytic Degradation of Glyphosate in Water by N-Doped SnO2/TiO2 Thin-Film-Coated Glass Fibers

Abstract

Photocatalytic degradation of glyphosate contaminated in water was investigated. The N-doped SnO2/TiO2 films were prepared via sol–gel method, and coated on glass fibers by dipping method. The effects of nitrogen doping on coating morphology, physical properties and glyphosate degradation rates were experimentally determined. Main variable was the concentration of nitrogen doping in range 0–40 mol%. Nitrogen doping results in shifting the absorption wavelengths and narrowing the band gap energy those lead to enhancement of photocatalytic performance. The near optimal 20N/SnO2/TiO2 composite thin film exhibited about two- and four-folds of glyphosate degradation rates compared to the undoped SnO2/TiO2 and TiO2 films when photocatalytic treatment were performed under UV and solar irradiations, respectively, due to its narrowest band gap energy (optical absorption wavelength shifting to visible light region) and smallest crystallite size influenced by N-doping.

Thumbnail image of graphical abstract

The N-doped SnO2/TiO2 films were prepared via sol–gel method, and coated on E-glass fibers by dipping method. Nitrogen doping resulted in shifting the absorption wavelength and narrowing the band gap energy leads to enhancement of photocatalytic performance. The optimal 20N/SnO2/TiO2 composite thin film exhibits about four-folds of glyphosate degradation rates compared to TiO2 and undoped SnO2/TiO2 as the tests performed under solar light irradiation.

Quelle: Photochemistry and Photobiology | 25 Sep 2014 | 12:18 pm CEST

Directed Improvement of Luciferin Regenerating Enzyme Binding Properties: Implication of Some Conserved Residues in Luciferin-Binding Domain

Abstract

Luciferin regenerating enzyme (LRE) contributes to in vitro recycling of d-luciferin to produce persistent and longer light emission by luciferase. Luciferin binding domains I and II among LREs regarded as potential candidates for luciferin-binding sites. In this study, for the first time, amino acids T69, G75 and K77 located at luciferin binding domain I of LRE from L. turkestanicus (T-LRE) substituted by using site-directed mutagenesis. Single mutant T69R increased luciferase light output more than two-fold over a longer time in comparison with a wild-type and other mutants of T-LRE. Nevertheless, double mutant (K77E/T69R) increased the amount of bioluminescent signal more than two-fold over a short time. In addition, G75E, K77E and G75E/T69R mutants did not improve luciferin–luciferase in vitro bioluminescence. Based on our results, addition of K77E/G75E and K77E/G75E/T69R mutants caused intermediate changes in bioluminescence from in vitro luciferin–luciferase reaction. These findings indicated that the amino acids in question are possible to be located within T-LRE active site. It may also be suggested that substituted Arg69 (Arg218) plays an important role in luciferin binding and the existence of Gly75 as well as Lys77 is essential for T-LRE which has already evolved to have different functions in nature.

Thumbnail image of graphical abstract

The addition of T-LRE single mutant T69R (LRE from Iranian firefly L. turkestanicus) to luciferin–luciferase reaction leads to decrease in bioluminescence decay over the time in comparison with wild-type T-LRE and control.

Quelle: Photochemistry and Photobiology | 22 Sep 2014 | 8:02 am CEST

Observation of In vivo Morphologic Changes after Carbon Dioxide Ablative Fractional Laser in a Mouse Model Using Noninvasive Imaging Modalities and Comparison with Histologic Examination

Abstract

Ablative fractional carbon dioxide (CO2) lasers have been widely used for several types of cosmetic dermatosis. A number of previous studies have evaluated this technique in animals or human beings by observing morphologic changes using an invasive modality such as skin biopsy. In this study, we assessed in vivo skin changes after CO2 ablative fractional laser treatment in a mouse model using noninvasive imaging modalities (Folliscope® and Visioscan 98®), and each results was compared with data from histologic examination. An ablative fractional CO2 laser was applied with different pulse energy between 7 to 35 mJ/microspot. As results of above methods, we also confirmed that the CO2 ablative fractional laser generated injuries with increasing width and depth with increasing pulse energy. Although numerous papers have described application of this laser in vivo skin specimens, our study evaluated the feasibility of using relative noninvasive imaging modalities for assessing the outcome of laser ablation. Based on our data, we suggest that these technologies may be useful alternative modalities for assessing laser ablation that are easier to perform and less invasive than skin biopsy.

Thumbnail image of graphical abstract

The ability to observe skin changes in vivo is important when evaluating the efficacy of laser treatment. This study was conducted to investigate the efficacy of the CO2 ablative fractional laser through using noninvasive imaging modalities (Folliscope® and Visioscan 98®) and tissue analysis. Although numerous previous reports have described a similar function of this laser in in vivo skin specimens, in this study we analyzed treatment effectiveness by noninvasive imaging modalities. Based on our data, we suggest that these technologies may be useful alternative modalities for assessing laser ablation that are easier to perform and less invasive than skin biopsy.

Quelle: Photochemistry and Photobiology | 22 Sep 2014 | 8:01 am CEST

Photodynamic Inactivation of Bacterial and Yeast Biofilms With a Cationic Porphyrin

Abstract

The efficiency of 5,10,15,20-tetrakis(1-methylpyridinium-4-yl)porphyrin tetra-iodide (Tetra-Py+-Me) in the photodynamic inactivation of single-species biofilms of Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans and mixed biofilms of S. aureus and C. albicans was evaluated. The effect on the extracellular matrix of P. aeruginosa was also assessed. Irradiation with white light up to an energy dose of 64.8 J cm−2 in the presence of 20 μm of Tetra-Py+-Me caused significant inactivation in all single-species biofilms (3–6 log reductions), although the susceptibility was attenuated in relation to planktonic cells. In mixed biofilms, the inactivation of S. aureus was as efficient as in single-species biofilms but the susceptibility of C. albicans decreased. In P. aeruginosa biofilms, a reduction of 81% in the polysaccharide content of the matrix was observed after treatment with a 20 μm PS concentration and a total light dose of 64.8 J cm−2. The results show that the Tetra-Py+-Me causes significant inactivation of the microorganisms, either in biofilms or in the planktonic form, and demonstrate that polysaccharides of the biofilm matrix may be a primary target of photodynamic damage.

Thumbnail image of graphical abstract

Irradiation with white light up to an energy dose of 64.8 J cm−2 in the presence of 20 µm of the cationic porphyrin 5,10,15,20-tetrakis(1-methylpyridinium-4-yl)porphyrin tetra-iodide caused a reduction of 3–6 log in the concentration of viable cells in biofilms of Pseudomonas aeruginosa, Staphylococcus aureus and Candida albicans and a 81% decrease in the concentration of polysaccharides in the matrix of P. aeruginosa biofilms. The results indicate that the biofilm matrix may be a primary target of photodynamic damage.

Quelle: Photochemistry and Photobiology | 22 Sep 2014 | 7:43 am CEST

What Caused the Formation of the Absorption Maximum at 421 nm in vivo Spectra of Rhodopseudomonas palustris

Abstract

A spectral peak at ~421 nm appeared in vivo spectrum of Rhodopseudomonas palustris CQV97 cultured in acetate–glutamate medium (M1) but not in acetate–ammonium sulfate medium (M2). However, the spectral origin of 421 nm peak was not clear and frequently attributed to carotenoid component(s). In this study, comparative analysis of the extracted components showed that magnesium protoporphyrin IX monomethylester (MPE) was accumulated as one of the predominate components in M1 culture. The amounts of bacteriochlorophyll a in M1 culture were higher than that in M2, whereas the amounts of carotenoids were nearly identical in both cultures. A simple, rapid and minimum interference with carotenoid and bacteriochlorophyll method to efficiently extract the compounds involving in the formation of 421 nm peak was developed in this study. Assembly of purified MPE with protein components from R. palustris in vitro demonstrated that MPE caused the formation of 421 nm peak. The localization analysis in vivo demonstrated it is MPE associating to protein components and accounting for the peak at ~421 nm. This work clarified the 421 nm peak in vivo mainly originated from MPE accumulation, and will be very helpful to further explore the physiological roles of MPE or its derivatives in photosynthesis.

Thumbnail image of graphical abstract

The 421 nm peak is frequently observed in various absorption spectra. However, less attention is attracted to examine its spectral origin. This study explored the formation origin of the absorption maximum at 421 nm in vivo with Rhodopseudomonas palustris for the first time. Our results ascertain that the 421 nm peak was a consequence of incorporation of magnesium protoporphyrin IX monomethylester (MPE), its accumulation inside cells could result in the formation of 421 nm peak. In addition, a simple, rapid, minimum interference and selective extraction strategy for MPE was developed. This work will helpful to characterize rationally the absorption spectra.

Quelle: Photochemistry and Photobiology | 18 Sep 2014 | 2:25 pm CEST

Forty Years of Research on Xeroderma Pigmentosum at the US National Institutes of Health

Abstract

In 1968, Dr. James Cleaver reported defective DNA repair in cultured cells from patients with xeroderma pigmentosum. This link between clinical disease and molecular pathophysiology has sparked interest in understanding not only the clinical characteristics of sun sensitivity, damage and cancer that occurred in XP patients but also the mechanisms underlying the damage and repair. While affected patients are rare, their exaggerated UV damage provides a window into the workings of DNA repair. These studies have clarified the importance of a functioning DNA repair system to the maintenance of skin and neurologic health in the general population. Understanding the role of damage in causing cancer, neurologic degeneration, hearing loss and internal cancers provides an opportunity for prevention and treatment. Characterizing complementation groups pointed to the importance of different underlying genes. Studying differences in cancer age of onset and underlying molecular signatures in cancers occurring either in XP patients or the general population has led to insights into differences in carcinogenic mechanisms. The accelerated development of cancers in XP has been used as a model to discover new cancer chemopreventive agents. An astute insight can be a “tipping point” triggering decades of productive inquiry.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 15 Sep 2014 | 10:16 am CEST

Hypericin Damages the Ectatic Capillaries in a Roman Cockscomb Model and Inhibits the Growth of Human Endothelial Cells More Potently Than Hematoporphyrin Does through Induction of Apoptosis

Abstract

Hypericin (HY) is a promising photosensitizer (PS) for use in photodynamic therapy (PDT). Port-wine stains (PWSs) are congenital superficial dermal capillary malformations. In this study, we evaluated the photocytotoxic effects of HY for PDT in human vascular endothelial cells and a chicken cockscomb model. HY significantly inhibited the growth of human umbilical vein endothelial cells (HUVECs), as determined by colorimetric assays and morphological observation, and flow cytometry assays indicated induction of apoptosis and collapse of the mitochondrial membrane potential. In addition, HY more effectively inhibited growth of and induced apoptosis in HUVECs compared with hematoporphyrin (HP). Further experiments performed in a Roman chicken cockscomb model also showed a clear photocytotoxic effect on the cockscomb dermal capillary upon intravenous injection of HY. This effect may be due to the role of HY in the induction of apoptosis. Transmission electron microscopical analysis showed mitochondrial morphological changes such as incomplete ridges and swelling, and immunohistochemical assays showed an increase in the release of cytochrome c. In conclusion, HY exhibited a greater photocytotoxic activity than did HP toward the growth of endothelial cells and may thus represent a potent PS for PWS PDT.

Thumbnail image of graphical abstract

Hypericin possesses more potent effects than hematoporphyrin in inhibition of growth and induction of apoptosis in a Roman Cockscomb Model and HUVECs.

Quelle: Photochemistry and Photobiology | 9 Sep 2014 | 9:35 am CEST

UVB Irradiation Enhances TiO2 Nanoparticle-induced Disruption of Calcium Homeostasis in Human Lens Epithelial Cells

Abstract

Currently, titanium dioxide nanoparticles (TiO2 NPs) have been widely used in various applications including cosmetics, food additives and biomedicine. However, there are few reports available using TiO2 NPs to treat ocular diseases. Posterior capsular opacification (PCO) is the most frequent complication after cataract surgery, which is induced by the proliferation and migration of lens epithelial cells. Thus, inhibiting the proliferation of lens epithelial cells will efficiently reduce the occurrence of PCO. In this study, we investigated the effects of TiO2 NPs on HLE B-3 cells with or without ultraviolet B (UVB) irradiation in vitro. We found that TiO2 NPs can inhibit HLE B-3 cell growth, cause the elevation of intracellular [Ca2+], produce excessive reactive oxygen species (ROS), further reduce Ca2+-ATPase activity and decrease the expression of plasma membrane calcium ATPase 1 (PMCA1), finally disrupt the intracellular calcium homeostasis and induce cell damage. Importantly, UVB irradiation can apparently enhance these effects on HLE B-3 cells in the presence of TiO2 NPs. Taken together, the generation of excessive ROS and the disruption of intracellular calcium homeostasis may be both involved in TiO2 nanoparticle-induced HLE B-3 cell damage under UVB irradiation.

Thumbnail image of graphical abstract

The scheme illustrates the possible pathway of intracellular Ca2+ elevation mediated by plasma membrane Ca2+-ATPase (PMCA). Excessive reactive oxygen species (ROS) were generated after HLE B-3 cells exposure to TiO2 NPs in the presence of UVB irradiation and the level of intracellular calcium ions was further elevated. The excessive ROS and the elevated intracellular Ca2+ level are both harmful to HLE B-3 cells via decreasing the expression of PMCA1 at gene and protein levels and inhibiting the Ca2+-ATPase activity, and further aggravate the disrupted intracellular calcium homeostasis, initiate Ca2+-dependent cellular apoptosis/necrosis signaling pathway and finally cause cell death.

Quelle: Photochemistry and Photobiology | 9 Sep 2014 | 9:35 am CEST

Proanthocyanidins from Grape Seeds Inhibit UV–Radiation-Induced Immune Suppression in Mice: Detection and Analysis of Molecular and Cellular Targets

Abstract

Ultraviolet (UV)–radiation-induced immunosuppression has been linked with the risk of skin carcinogenesis. Approximately, 2 million new cases of skin cancers, including melanoma and nonmelanoma, diagnosed each year in the USA and therefore have a tremendous bad impact on public health. Dietary phytochemicals are promising options for the development of effective strategy for the prevention of photodamaging effects of UV radiation including the risk of skin cancer. Grape seed proanthocyanidins (GSPs) are such phytochemicals. Dietary administration of GSPs with AIN76A control diet significantly inhibits UV-induced skin tumor development as well as suppression of immune system. UV-induced suppression of immune system is commonly determined using contact hypersensitivity (CHS) model which is a prototype of T–cell-mediated immune response. We present evidence that inhibition of UV-induced suppression of immune system by GSPs is mediated through: (i) the alterations in immunoregulatory cytokines, interleukin (IL)-10 and IL-12, (ii) DNA repair, (iii) stimulation of effector T cells and (iv) DNA repair-dependent functional activation of dendritic cells in mouse model. These information have important implications for the use of GSPs as a dietary supplement in chemoprevention of UV-induced immunosuppression as well as photocarcinogenesis.

Thumbnail image of graphical abstract

Prevention of UV–radiation-induced immunosuppression by dietary grape seed proanthocyanidins is mediated through: (i) alterations in immunoregulatory cytokines, such as, IL-10 and IL-12, (ii) stimulation of DNA repair and (iii) DNA repair-dependent functional activation of dendritic cells in mice.

Quelle: Photochemistry and Photobiology | 8 Sep 2014 | 8:42 am CEST

The Effects of UV-B Radiation Intensity on Biochemical Parameters and Active Ingredients in Flowers of Qi Chrysanthemum and Huai Chrysanthemum

Abstract

The article studied UV-B effects on biochemical parameters and active ingredients in flowers of Qi chrysanthemum and Huai chrysanthemum during the bud stage. The experiment included four UV-B radiation levels (CK, ambient UV-B; T1, T2 and T3 indicated a 5%, 10% and 15% increase in ambient UV-BBE, respectively) to determine the optimal UV-B radiation intensity in regulating active ingredients level in flowers of two chrysanthemum varieties. Flower dry weight of two cultivars was not affected by UV-B radiation under experimental conditions reported here. UV-B treatments significantly increased the rate of superoxide radical production, hydrogen peroxide (H2O2) (except for T1) and malondialdehyde concentration in flowers of Huai chrysanthemum and H2O2 concentration in flowers of Qi chrysanthemum. T2 and T3 treatments induced a significant increase in phenylalanine ammonia lyase enzyme (PAL) activity, anthocyanins, proline, ascorbic acid, chlorogenic acid and flavone content in flowers of two chrysanthemum varieties, and there were no significant differences in PAL activity, ascorbic acid, flavone and chlorogenic acid content between the two treatments. These results indicated that appropriate UV-B radiation intensity did not result in the decrease in flower yield, and could regulate PAL activity and increase active ingredients content in flowers of two chrysanthemum varieties.

Thumbnail image of graphical abstract

The article mainly studied UV-B effects on active ingredients in flowers of two chrysanthemum varieties during the bud stage. The experiment included four UV-B radiation levels (CK, ambient UV-B; T1, T2 and T3 indicated a 5%, 10% and 15% increase in ambient UV-BBE, respectively). The results indicated that appropriate UV-B radiation intensity did not result in the decrease in flower yield, and could increase chlorogenic acid and flavone content in flowers of two varieties.

Quelle: Photochemistry and Photobiology | 8 Sep 2014 | 8:32 am CEST

A New Series of Fluorescent Indicators for Super Acids

Abstract

The photophysical properties of fluorescent Hammett acidity indicator derived from 3,4,5,6-tetrahydrobis(pyrido[3,2-g]indolo)[2,3-a:3′,2′-j]acridine (1a), 6-bis(pyrido[3,2-g]indol-2′-yl)pyridine (1b) and their analogues have been investigated in sulfuric acid solutions by means of absorption, fluorimetry, relaxation dynamics and computational approach. These new indicators undergo a reversible protonation process in the Hammett acidity range of H0 < 0, accompanied by a drastic increase of the bright blue-green (1a) or yellow (1b) fluorescence intensity upon increasing the acidity. For 1a in H2SO4, the emission yield increases as large as 200 folds from pH = −0.41 to the Hammett acidity range of −5.17, the results of which are rationalized by a much increase of the steric hindrance upon third protonation toward the central pyridinic site, together with their accompanied changes of electronic configuration from charge transfer to a delocalized ππ* character in the lowest lying excited state. The combination of 1a and 1b renders a wide and linear range of H0 measurement from −1.2 to −5.1 detected by highly intensive fluorescence.

Thumbnail image of graphical abstract

A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pKa as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

Quelle: Photochemistry and Photobiology | 6 Sep 2014 | 2:11 pm CEST

Rapid Sonosynthesis of N-Doped Nano TiO2 on Wool Fabric at Low Temperature: Introducing Self-cleaning, Hydrophilicity, Antibacterial/Antifungal Properties with low Alkali Solubility, Yellowness and Cytotoxicity

Abstract

Nano nitrogen-doped titanium dioxide was rapidly prepared by hydrolysis of titanium isopropoxide at 75–80°C using in situ sonochemical synthesis by introducing ammonia. Various concentrations of titanium isopropoxide were examined to deposit nano nitrogen-doped titanium dioxide through impregnation of the wool fabric in ultrasound bath followed by curing. The antibacterial/antifungal activities of wool samples were assessed against two common pathogenic bacteria including Escherichia coli and Staphylococcus aureus and the diploid fungus Candida albicans. The sonotreated wool fabrics indicated no adverse effects on human dermal fibroblasts. The presence of nanoparticles on the sonotreated wool fabrics were confirmed by FE-SEM images and EDS patterns and X-ray mapping and the crystalline size of nanoparticles were estimated through XRD results. The role of both pH and precursor concentration on the various properties of the fabric was investigated and the optimized conditions introduced using response surface methodology.

Thumbnail image of graphical abstract

A novel simple short time in situ sonosynthesis method for simultaneous synthesis of N-doped TiO2 on wool is introduced. This is provided through treatment of wool fabric in ultrasound bath including TTIP in water/ethanol at pH = 7.5 (using ammonia) and 80°C for 1 h. This produces wool fabric with self-cleaning, antibacterial/antifungal and hydrophilicity properties with lower yellowness and alkali solubility at higher tensile strength along with no cytotoxicity. All of these confirmed through different analysis techniques and optimized through RSM.

Quelle: Photochemistry and Photobiology | 6 Sep 2014 | 9:37 am CEST

Hydroxyl Radical as an Unlikely Key Intermediate in the Photodegradation of Emerging Pollutants

Abstract

In this work, a kinetic model, in combination with time-resolved experiments, is applied to assess the involvement of ·OH in the photodegradation of emerging pollutants (EPs) by means of advanced oxidation processes. In contrast with the general assumption, quenching of the short-lived ·OH in the real waters by the (highly diluted) EPs must be very inefficient, so removal of EPs cannot purely rely on the generation and reaction of ·OH. This suggests that more complex pathways have to be considered to explain the photodegradation of EPs actually achieved under the employed oxidative conditions, possibly involving other reactive species with longer lifetimes or chain degradation processes.

Thumbnail image of graphical abstract

In the real (diluted) emerging pollutants (EPs)-containing waters, quenching of the short-lived ·OH must be very inefficient. In other words, EPs photodegradation cannot purely rely on the generation and reaction of ·OH. Hence, alternative pathways have to be considered to explain the oxidative photodegradation of EPs actually achieved under AOPs conditions.

Quelle: Photochemistry and Photobiology | 6 Sep 2014 | 9:37 am CEST

Enhanced Light-Harvesting Capacity by Micellar Assembly of Free Accessory Chromophores and LH1-like Antennas

Abstract

Biohybrid light-harvesting antennas are an emerging platform technology with versatile tailorability for solar-energy conversion. These systems combine the proven peptide scaffold unit utilized for light harvesting by purple photosynthetic bacteria with attached synthetic chromophores to extend solar coverage beyond that of the natural systems. Herein, synthetic unattached chromophores are employed that partition into the organized milieu (e.g. detergent micelles) that house the LH1-like biohybrid architectures. The synthetic chromophores include a hydrophobic boron-dipyrrin dye (A1) and an amphiphilic bacteriochlorin (A2), which transfer energy with reasonable efficiency to the bacteriochlorophyll acceptor array (B875) of the LH1-like cyclic oligomers. The energy-transfer efficiencies are markedly increased upon covalent attachment of a bacteriochlorin (B1 or B2) to the peptide scaffold, where the latter likely acts as an energy-transfer relay site for the (potentially diffusing) free chromophores. The efficiencies are consistent with a Förster (through-space) mechanism for energy transfer. The overall energy-transfer efficiency from the free chromophores via the relay to the target site can approach those obtained previously by relay-assisted energy transfer from chromophores attached at distant sites on the peptides. Thus, the use of free accessory chromophores affords a simple design to enhance the overall light-harvesting capacity of biohybrid LH1-like architectures.

Thumbnail image of graphical abstract

Biohybrid light-harvesting antennas have been created that comprise LH1-like biohybrid architectures (with or without an attached synthetic bacteriochlorin) and free synthetic chromophores (hydrophobic boron-dipyrrin dye or an amphiphilic bacteriochlorin) in detergent micelles. The synthetic chromophores transfer energy directly or via relay processes to the bacteriochlorophyll acceptor array (B875) of the LH1-like cyclic oligomers.

Quelle: Photochemistry and Photobiology | 5 Sep 2014 | 12:51 pm CEST

Self-aggregation of Synthetic Zinc Chlorophyll Derivatives Possessing 31-Hydroxy or Methoxy Group and 131-Mono- or Dicyanomethylene Moiety in Nonpolar Organic Solvents as Models of Chlorosomal Bacteriochlorophyll-d Aggregates

Abstract

Methyl 131-(di)cyanomethylene-pyropheophorbides were synthesized by Knoevenagel reactions of the corresponding 131-oxo-chlorins prepared from modifying chlorophyll-a with malononitrile or cyanoacetic acid. Alternatively, methyl 131-cyanomethylene-pyropheophorbides were produced by Wittig reactions of 131-oxo-chlorins with Ph3P=CHCN. Self-aggregation of zinc complexes of the semi-synthetic chlorophyll derivatives possessing a hydroxy or methoxy group at the 31-position was examined in 1%(v/v) tetrahydrofuran or dichloromethane and hexane by electronic absorption and circular dichroism spectroscopy. Although intermolecular hydrogen-bonding between the 31-hydroxy and 131-oxo groups of bacteriochlorophylls-c/d/e/f was essential for their self-aggregation in natural light-harvesting antenna systems (=chlorosomes), zinc 31-hydroxy-131-di/monocyanomethylene-chlorins self-aggregated in the less/lesser polar organic solvents to form chlorosome-like large oligomers in spite of lacking the 131-oxo moiety as the hydrogen-bonding acceptor. Zinc 31-methoxy-131-dicyanomethylene-chlorin gave similar self-aggregates regardless of lack of both the 31-hydroxy and 131-oxo groups. The present self-aggregation was ascribable to stronger coordination of the 31-oxygen atom to the central zinc than the conventional systems, where the electron-withdrawing cyano group(s) increased the coordinative ability of the central zinc through the chlorin π-system.

Thumbnail image of graphical abstract

A synthetic zinc chlorophyll-a derivative possessing the 31-hydroxy and 131-dicyanomethylene groups self-aggregated in 1% THF–hexane despite lacking the 131-oxo moiety as a hydrogen-bonding acceptor to give chlorosome-like large oligomers with its Qy band at a near-infrared region.

Quelle: Photochemistry and Photobiology | 1 Sep 2014 | 1:12 pm CEST

Validation and Application of a Model of Oxygen Consumption and Diffusion During Photodynamic Therapy In Vitro

Abstract

The photophysical parameters for the photosensitizer Pd(II) meso-Tetra(4-carboxyphenyl) porphine (PdT790) acquired in a previous study were incorporated into the PDT oxygen diffusion models for cell suspensions and cell monolayers. The time-dependent phosphorescence signals generated by the diffusion models are shown to match signals previously measured by M.A.W. and M.S.P. when reasonable physical and photophysical parameters are used. Simulations were performed to investigate the effects of metabolic and photodynamic oxygen consumption rates on the PDT dose in each of the treatment geometries. It was found that in cell suspensions of <1 million cells per mL, PDT should not be inhibited by hypoxia if the photodynamic consumption rate is <1 mm s−1. For cell monolayers the optimal photodynamic oxygen consumption rate was found to depend on the metabolic rate of oxygen consumption. If cells remained well oxygenated in the absence of PDT, then maximum PDT dose was delivered with the lowest practical photodynamic oxygen consumption rate. Simulations of PDT treatments for multicell tumor spheroids showed that large anoxic cores develop within the spheroids and, as a consequence, less PDT dose is delivered in comparison with similar treatments in cell suspensions and cell monolayers.

Thumbnail image of graphical abstract

Previously acquired phosphorescence signals generated during Pd(II) meso-Tetra(4-carboxyphenyl) porphine-PDT of cells in monolayers and suspensions are shown to be well described by PDT oxygen diffusion models. The diffusion models are used to determine the photodynamic oxygen consumption rates and in essence the treatment fluence rates, that maximize PDT dose in each of the treatment geometries. The cell suspension diffusion model was extended to describe multicell tumor spheroids. Due to large anoxic cores that develop during PDT, much less PDT dose is delivered to spheroids in comparison with similar treatments in cell suspensions and cell monolayers.

Quelle: Photochemistry and Photobiology | 1 Sep 2014 | 1:11 pm CEST

Simultaneous Irradiation with Different Wavelengths of Ultraviolet Light has Synergistic Bactericidal Effect on Vibrio parahaemolyticus

Abstract

Ultraviolet (UV) irradiation is an increasingly used method of water disinfection. UV rays can be classified by wavelength into UVA (320–400 nm), UVB (280-320 nm), and UVC (<280 nm). We previously developed UVA sterilization equipment with a UVA light-emitting diode (LED). The aim of this study was to establish a new water disinfection procedure using the combined irradiation of the UVA-LED and another UV wavelength. An oxidative DNA product, 8-hydroxy-2’-deoxyguanosine (8-OHdG), increased after irradiation by UVA-LED alone, and the level of cyclobutane pyrimidine dimers (CPDs) was increased by UVC alone in Vibrio parahaemolyticus. Although sequential irradiation of UVA-LED and UVC-induced additional bactericidal effects, simultaneous irradiation with UVA-LED and UVC-induced bactericidal synergistic effects. The 8-OHdG and CPDs production showed no differences between sequential and simultaneous irradiation. Interestingly, the recovery of CPDs was delayed by simultaneous irradiation. The synergistic effect was absent in SOS response-deficient mutants, such as the recA and lexA strains. Because recA- and lexA-mediated SOS responses have crucial roles in a DNA repair pathway, the synergistic bactericidal effect produced by the simultaneous irradiation could depend on the suppression of the CPDs repair. The simultaneous irradiation of UVA-LED and UVC is a candidate new procedure for effective water disinfection.

Thumbnail image of graphical abstract

Bactericidal damages induced by UVA (320–400 nm) and UVC (<280 nm) are different. In this study, we revealed that simultaneous irradiation with UVA-LED (365 nm) and UVC (254 nm) induced bactericidal synergistic effects and suppressed the recovery of cyclobutane pyrimidine dimers (CPDs). The synergistic effect was absent in SOS response-deficient strains, such as the recA and lexA mutants. Because recA- and lexA- mediated SOS responses have crucial roles in DNA repair pathway, the synergistic bactericidal effect produced by the simultaneous irradiation could depend on suppression of the CPDs repair. This simultaneous irradiation is a candidate new procedure for effective water disinfection.

Quelle: Photochemistry and Photobiology | 28 Aug 2014 | 1:58 pm CEST

In Vitro Investigations on the Effect of Dermal Fibroblasts on Keratinocyte Responses to Ultraviolet B Radiation

Abstract

Exposure to ultraviolet radiation is closely linked to the development of skin cancers in humans. The ultraviolet B (UVB) radiation wavelength (280–320 nm), in particular, causes DNA damage in epidermal keratinocytes, which are linked to the generation of signature premalignant mutations. Interactions between dermal fibroblasts and keratinocytes play a role in epidermal repair and regeneration after UVB-induced damage. To investigate these processes, established two and three-dimensional culture models were utilized to study the impact of fibroblast–keratinocyte crosstalk during the acute UVB response. Using a coculture system it was observed that fibroblasts enhanced keratinocyte survival and the repair of cyclobutane pyrimidine dimers (CPDs) after UVB radiation exposure. These findings were also mirrored in irradiated human skin coculture models employed in this study. Fibroblast coculture was shown to play a role in the expression and activation of members of the apoptotic cascade, including caspase-3 and Bad. Interestingly, the expression and phosphorylation of p53, a key player in the regulation of keratinocyte cell fate postirradiation, was also shown to be influenced by fibroblast-produced factors. This study highlights the importance of synergistic interactions between fibroblasts and keratinocytes in maintaining a functional epidermis while promoting repair and regeneration following UVB radiation-induced damage.

Thumbnail image of graphical abstract

Cellular cross-talk between dermal fibroblasts and epidermal keratinocytes is critical for orchestrating cutaneous repair and regeneration. Herein, we describe the influence of keratinocyte–fibroblast interactions on key processes in the ultraviolet B photoresponse. Importantly, fibroblast-produced factors were observed to enhance keratinocyte survival and DNA repair by regulating the expression of specific apoptotic and cell cycle regulation proteins.

Quelle: Photochemistry and Photobiology | 19 Aug 2014 | 9:17 am CEST

Red Light Interferes in UVA-Induced Photoaging of Human Skin Fibroblast Cells

Abstract

The possible regulation mechanism of red light was determined to discover how to retard UVA-induced skin photoaging. Human skin fibroblasts were cultured and irradiated with different doses of UVA, thus creating a photoaging model. Fibroblasts were also exposed to a subtoxic dose of UVA combined with a red light-emitting diode (LED) for five continuous days. Three groups were examined: control, UVA and UVA plus red light. Cumulative exposure doses of UVA were 25 J cm−2, and the total doses of red light were 0.18 J cm−2. Various indicators were measured before and after irradiation, including cell morphology, viability, β-galactosidase staining, apoptosis, cycle phase, the length of telomeres and the protein levels of photoaging-related genes. Red light irradiation retarded the cumulative low-dose UVA irradiation-induced skin photoaging, decreased the expression of senescence-associated β-galactosidase, upregulated SIRT1 expression, decreased matrix metalloproteinase MMP-1 and the acetylation of p53 expression, reduced the horizon of cell apoptosis and enhanced cell viability. Furthermore, the telomeres in UVA-treated cells were shortened compared to those of cells in the red light groups. These results suggest that red light plays a key role in the antiphotoaging of human skin fibroblasts by acting on different signaling transduction pathways.

Thumbnail image of graphical abstract

This study demonstrated the use of LED red light with a wavelength of 633 nm leads to an attenuation of subtoxic UVA irradiation-induced skin photoaging. Red light intervention decreased the expression of senescence-associated β-galactosidase, upregulated SIRT1 expression, decreased matrix metalloproteinase MMP-1 and the acetylation of p53 expression. Our results suggest that red light plays a key role in the antiphotoaging of human skin fibroblasts by acting on different signaling transduction pathways.

Quelle: Photochemistry and Photobiology | 18 Aug 2014 | 1:53 pm CEST

Photooxidation of Tryptophan Leading to 2-Aminoacetophenone – A Possible Reason for the Untypical Aging Off-flavor in Wine

Abstract

2-Aminoacetophenone (AAP) was recognized as the key compound for the so-called untypical aging off-flavor (UTA) in Vitis vinifera wines. In this study, it was shown that AAP can be formed by photooxidation of free and protein-bound tryptophan (TRP) in combination with a subsequent storage in model wine. Solutions of TRP and lysozyme were exposed to artificial sunlight both in the presence and in the absence of the photosensitizer riboflavin. Aliquots of the irradiation batches were stored in model wine solutions containing tartaric acid, sulfite and ethanol in different combinations. AAP formation could be identified from both free and bound (lysozyme) TRP, while free TRP resulted in higher yields. The presence of riboflavin during irradiation generally favored the AAP formation. AAP formation increased with increasing irradiation times, but AAP was not detectable, if TRP was directly incubated in model wine. Not only the irradiation time but also the storage time of model wines favored the formation of AAP. Concerning the model wine composition, it became evident that the presence of tartaric acid resulted in the highest AAP formation during storage.

Thumbnail image of graphical abstract

2-Aminoacetophenone (AAP) is known as the key compound for the so-called untypical aging off-flavor (UTA) in Vitis vinifera wines. In the present work we show that photooxidation of tryptophan (free and bound) in combination with a subsequent storage in model wine leads to the formation of AAP. Furthermore, we could show that the AAP formation mechanism proceeds via N-formyl-2-aminoacetophenone (FAP), but not exclusively. Both time of irradiation and time of storage in model wines greatly favored the formation of AAP.

Quelle: Photochemistry and Photobiology | 18 Aug 2014 | 1:53 pm CEST

Sun protection Provided by Regulation School Uniforms in Australian Schools: An Opportunity to Improve Personal Sun protection During Childhood

Abstract

Childhood sun exposure is linked to excessive pigmented mole development and melanoma risk. Clothing provides a physical barrier, protecting skin from ultraviolet radiation (UVR). Extending sleeves to elbow length and shorts to knee length has been shown to significantly reduce mole acquisition in preschoolers from tropical Queensland. We used publicly available uniform images and guidelines from primary schools in Townsville (latitude 19.25°S, n = 43 schools), Cairns (16.87°S, n = 46) and the Atherton Tablelands (17.26°S, n = 23) in tropical Australia to objectively determine the body surface proportion covered by regulation school uniforms. Uniforms of nongovernment, large (≥800 students), urban, educationally advantaged schools with comprehensive sun protection policies covered more skin than those of government schools (63.2% vs 62.0%; P < 0.001), smaller schools (63.4% vs 62.3%; P = 0.009), rural (62.7% vs 61.9%; P = 0.002) and educationally disadvantaged schools (62.8% vs 62.3%; P < 0.001) with underdeveloped sun protection policies (62.8% vs 62.2%; P = 0.002). Overall, SunSmart and non-SunSmart school uniforms covered identical body surface proportions (62.4%, P = 0.084). Although wearing regulation school uniforms is mandatory at most Australian primary schools, this opportunity to improve children's sun protection is largely overlooked. Recent evidence suggests that even encouraging minor alterations to school uniforms (e.g. slightly longer sleeves/dresses/skirts/shorts) to increase skin coverage may reduce mole acquisition and melanoma risk, especially in high-risk populations.

Thumbnail image of graphical abstract

Ultra violet exposure during the childhood years is linked to the development of melanocytic nevi (moles) which are a risk factor for the development cutaneous melanoma. Sun-protective clothing protects the skin from ultra violet radiation, reducing the development of melanocytic nevi and skin cancer risk. Simple alterations to school uniforms (such as slightly longer sleeves and hems) would increase body surface area covered without causing heat stress. Sensibly designed school uniforms/clothing would be a practical way to protect school children from ultra violet radiation. Body surface area covered needs to be added to clothing standards.

Quelle: Photochemistry and Photobiology | 18 Aug 2014 | 1:52 pm CEST

Effect of Immunosuppressants Tacrolimus and Mycophenolate Mofetil on the Keratinocyte UVB Response

Abstract

Nonmelanoma skin cancer, derived from epidermal keratinocytes, is the most common malignancy in organ transplant recipients, causes serious morbidity and mortality, and is strongly associated with solar ultraviolet (UV) exposure. Preventing and treating skin cancer in these individuals has been extraordinarily challenging. Following organ transplantation, the immunosuppressants are used to prevent graft rejection. Until now, immunosuppression has been assumed to be the major factor leading to skin cancer in this setting. However, the mechanism of skin carcinogenesis in organ transplant recipients has not been understood to date; specifically, it remains unknown whether these cancers are immunosuppression-dependent or -independent. In particular, it remains poorly understood what is the mechanistic carcinogenic action of the newer generation of immunosuppressants including tacrolimus and mycophenolate mofetil (MMF). Here, we show that tacrolimus and MMF impairs UVB-induced DNA damage repair and apoptosis in human epidermal keratinocytes. In addition, tacrolimus inhibits UVB-induced checkpoint signaling. However, MMF had no effect. Our findings have demonstrated that tacrolimus and MMF compromises proper UVB response in keratinocytes, suggesting an immunosuppression-independent mechanism in the tumor-promoting action of these immunosuppressants.

Thumbnail image of graphical abstract

This study investigated the effects of the newer generation of immunosuppressants including tacrolimus and mycophenolate mofetil (MMF) on keratinocyte UVB response. Tacrolimus and MMF impairs UVB-induced DNA repair and apoptosis in human keratinocytes. In addition, tacrolimus inhibits UVB-induced checkpoint signaling, while MMF had no effect. Our findings have demonstrated that tacrolimus and MMF compromises proper keratinocyte UVB response, suggesting an immunosuppression-independent mechanism in the tumor-promoting action of these immunosuppressants.

Quelle: Photochemistry and Photobiology | 12 Aug 2014 | 8:36 am CEST

Study of the Photodegradation Kinetics and Pathways of Hexaflumuron in Liquid Media

Abstract

Hexaflumuron, one of the benzoylphenylurea insect growth regulators, can be leached into surface water and thus having a potential impact on aquatic organisms. In this study, the photodegradation processes of hexaflumuron under high-pressure mercury lamp irradiation were assessed. The photodegradation kinetics were studied, as were the effects of pH, different light sources, organic solvents and environmental substances, including nitrate ions (NO3), nitrite ions (NO2), ferrous ions (Fe2+), ferric ions (Fe3+), humic acid, sodium dodecyl sulfate (SDS) and hydrogen peroxide (H2O2). Three photodegradation products in methanol were identified by gas chromatography-mass spectrometry (GC-MS). In general, the degradation of hexaflumuron followed first-order kinetics. In the four media studied, the photodegradation rate order was n-hexane > methanol > ultrapure water > acetone. Faster degradation was observed under high-pressure mercury lamp irradiation than under xenon lamp irradiation. The pH had a considerable effect, with the most rapid degradation occurring at pH 5.0. The photodegradation rate of hexaflumuron was promoted in the presence of NO3, NO2, Fe2+, humic acid, SDS and H2O2, but inhibited by Fe3+. Moreover, the presumed photodegradation pathway was proposed to be the cleavage of the urea linkage.

Thumbnail image of graphical abstract
  1. The photodegradation kinetics of hexaflumuron under irradiation were investigated.
  2. Effects of light sources, pH values, organic solvents and water substances on hexaflumuron photodegradation were analyzed.
  3. Three photodegradation products were identified by GC-MS and the presumed photodegradation pathways of hexaflumuron in methanol were proposed.

Quelle: Photochemistry and Photobiology | 12 Aug 2014 | 8:36 am CEST

The Injury and Cumulative Effects on Human Skin by UV Exposure from Artificial Fluorescence Emission

Abstract

The injury and cumulative effects of UV emission from fluorescence lamp were studied. UV intensity from fluorescence lamp was measured, and human skin samples (hips, 10 volunteers) were exposed to low-dose UV irradiation (three times per week for 13 consecutive weeks). Three groups were examined: control group without UV radiation; low-dose group with a cumulative dose of 50 J cm−2 which was equivalent to irradiation of the face during indoor work for 1.5 years; and high-dose group with 1000 J cm−2 cumulative dose equivalent to irradiation of the face during outdoor activities for 1 year. Specific indicators were measured before and after UVA irradiation. The findings showed that extending the low-dose UVA exposure decreased the skin moisture content and increased the transepidermal water loss as well as induced skin color changes (decreased L* value, increased M index). Furthermore, irradiated skin showed an increased thickness of cuticle and epidermis, skin edema, light color and unclear staining collagen fibers in the dermis, and elastic fiber fragmentation. In addition, MMP-1, p53 and SIRT1 expression was also increased. Long-term exposure of low-dose UVA radiation enhanced skin photoaging. The safety of the fluorescent lamp needs our attention.

Thumbnail image of graphical abstract

The injury and cumulative effects of UV emission from compact fluorescence lamp (CFL) were studied on human skin. (A) HE staining. The thickness of the cuticle and epidermis increased. Dermal collagen fibers were clumped and aggregated with light color and unclear staining; (B) Elastic fiber staining. Fragmentation of the elastic fibers and intermittent zonal distribution was observed; (C) MMP-1 expression. The staining intensity of MMP-1 increased; (D) SIRT1 expression. Both staining intensity and area of SIRT1 increased; (E) p53 expression. The staining intensity of p53 expression increased.

Quelle: Photochemistry and Photobiology | 5 Aug 2014 | 6:04 am CEST

Photoactive Hybrid Materials of Lanthanide (Eu3+, Tb3+, Sm3+) Beta-Diketonates and Polymer Resin Through Ionic Liquid Bridge

Abstract

A special multifunctional ionic liquid compound (1-methyl-3-(2-(thiocarboxyoxy)-ethyl)-2H-imidazole-1,3-diium bromide (SHIL)) is used as the chemical bridge to link lanthanide beta-diketonates and polymer resin, which are designated as Ln(L)4-SHIL-WR/MR (Ln = Eu, Tb, Sm; L = thenoyltrifluoroacetonate (TTA), acetylacetonate (AA), dibenzoylmethane (DBM); WR = Wang resin, MR = Merrifield resin). Among SHIL and polymer resin are assembled to form covalently bonded system through condensation reaction. Then tetrakis lanthanide beta-diketonates are linked to SHIL through ion-exchange reaction. Physical characterization and especially the photoluminescent performance of the multicomponent hybrids are studied. The hybrid materials possess good stability and excellent luminescent property. The results provide useful path to obtain luminescent hybrids for further practical application.

Thumbnail image of graphical abstract

A special multifunctional ionic liquid compound (1-methyl-3-(2-(thiocarboxyoxy)-ethyl)-2H-imidazole-1,3-diium bromide (SHIL)) is engaged as the chemical bridge to link lanthanide beta-diketonates and polymer sphere-like resin to construct the hybrid materials Ln(L)4-SHIL-WR/MR. The results provide a novel path to construct photofunctional hybrids for further device application.

Quelle: Photochemistry and Photobiology | 31 Jul 2014 | 11:06 am CEST

ROS and p53 in Regulation of UVB-induced HDM2 Alternative Splicing

Abstract

Alternative splicing plays an important role in proteasome diversity and gene expression regulation in eukaryotic cells. Hdm2, the human homolog of mdm2 (murine double minute oncogene 2), is known to be an oncogene as its role in suppression of p53. Hdm2 alternative splicing, occurs in both tumor and normal tissues, is believed to be a response of cells for cellular stress, and thus modulate p53 activity. Therefore, understanding the regulation of hdm2 splicing is critical in elucidating the mechanisms of tumor development and progression. In this study, we determined the effect of ultraviolet B light (UVB) on alternative splicing of hdm2. Our data indicated that UVB (50 mJ cm−2) alone is not a good inducer of alternative splicing of hdm2. The less effectiveness could be due to the induction of ROS and p53 by UVB because removing ROS by L-NAC (10 mm) in p53 null cells could lead to alternative splicing of hdm2 upon UVB irradiation.

Thumbnail image of graphical abstract

Hdm2, the human homologue of mdm2 (murine double minute oncogene 2), is an oncogene for its role in suppression of p53. Hdm2 alternative splicing, occurs in both tumor and normal tissues, is suggested to be a response of cells for cellular stress, and thus modulate p53 activity. In this study, we demonstrated that UVB is weaker inducer of alternative splicing than UVC is. We also provided evidences that the UV-induced alternative splicing is promoted by DNA-damage, but suppressed by ROS formation and p53 activity of the irradiated cells.

Quelle: Photochemistry and Photobiology | 26 Jul 2014 | 7:02 am CEST

Xeroderma Pigmentosum in the United Kingdom

Abstract

The seminal discovery by James Cleaver of defective DNA repair in xeroderma pigmentosum (XP) opened up an ever-expanding field of DNA repair-related disorders. In addition, it put XP on the map and has led to improved diagnosis, care and management of affected patients. In the United Kingdom, we recently established a multidisciplinary specialist clinic for XP patients. All XP patients in the United Kingdom are able to visit the clinic where they are examined and advised by a team of specialists with detailed knowledge of the different aspects of XP.

Thumbnail image of graphical abstract

Early diagnosis and rigorous protection from daylight can completely prevent the skin problems in XP. Patient XP59BR (left) has had poor protection from daylight and has developed many skin cancers. In contrast, patient XPJCLO was diagnosed in his first year of life, has been rigorously protected from sunlight and has not developed any significant skin lesions. Curiously, despite having similar mutations in the XPD gene, XP59BR has no severe neurological problems, whereas XPJCLO has shown features of neurological degeneration since the age of 2. Photographs published with consent of patient or their family.

Quelle: Photochemistry and Photobiology | 14 Jul 2014 | 7:37 am CEST

Effect of Light on Expression of Clock Genes in Xenopus laevis Melanophores

Abstract

Light-dark cycles are considered important cues to entrain biological clocks. A feedback loop of clock gene transcription and translation is the molecular basis underlying the mechanism of both central and peripheral clocks. Xenopus laevis embryonic melanophores respond to light with melanin granule dispersion, response possibly mediated by the photopigment melanopsin. In order to test whether light modulates clock gene expression in Xenopus melanophores, we used qPCR to evaluate the relative mRNA levels of Per1, Per2, Clock and Bmal1 in cultured melanophores exposed to light-dark (LD) cycle or constant darkness (DD). LD cycles elicited temporal changes in the expression of Per1, Per2 and Bmal1. A 10-min pulse of blue light was able to increase the expression of Per1 and Per2. Red light had no effect on the expression of these clock genes. These data suggest the participation of a blue-wavelength sensitive pigment in the light-dark cycle-mediated oscillation of the endogenous clock. Our results add an important contribution to the emerging field of peripheral clocks, which in non-mammalian vertebrates have been mostly studied in Drosophila and Danio rerio. Within this context, we show that Xenopus laevis melanophores, which have already led to melanopsin discovery, represent an ideal model to understanding circadian rhythms.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 26 Dec 2013 | 1:09 pm CET




 


Sonstige Hinweise:


Ueber diese Seite:

 

Urheber und Verantwortlich fuer die Inhalte der verlinkten Artikel sind die in den Quellen genannten Anbieter.

 

Hinweise zur Veroeffentlichung Ihrer Pressemitteilung im Bereich Chemie und angrenzende Fachgebiete

Update:

08.10.2009

Thema:

Chronologische Liste mit Fachartikeln zum Thema Photochemie.

Benutzerdefinierte Suche

Internetchemie Copyright: 2007 - 2009 A. J.