[ Sitemap ] [ Kontakt ] [ Impressum ] [ ] Volltext Suche Chemie


Home


Weiteres zum Thema:

Photochemie

Buecher zum Thema


Themenbezogene Artikel

- Biolumineszenz

- Chemie, allgemein

- Fluoreszenz

- Fotosynthese

Weitere Themenbereiche

English Version


Verwandte Themen:

Physikalische Chemie


Aktuelles

Chemie Nachrichten

Stellenmarkt Chemie

Chemie Konferenzen


Chemie A bis Z

Index Chemie

Chemikalien

Internetchemie Lexikon

Produkte und Firmen


About Internetchemie

Internetchemie

Impressum

Service




Photochemie - Neueste Forschungsartikel der Fachverlage


 
Aktuelle Fachartikel zur Photochemie und Photobiologie, sortiert nach Erscheinungsdatum.

Die Urheberrechte und Veroeffentlichungsrechte der in der nachfolgenden Liste aufgefuehrten Fachartikel liegen bei den jeweiligen Verlagen, die am Ende des jeweiligen Artikels als Quelle genannt werden. Diese sind auch fuer die Inhalte verantwortlich.

Hinweise zur Veroeffentlichung Ihrer Pressmitteilung unter Internetchemie.Info entnehmen Sie bitte der entsprechenden Info-Seite.

Diese Seite koennen Sie mit folgender Tastenkombination nach Stichwoertern durchsuchen: <STRG> und <F>.


Auf dieser Seite beruecksichtige naturwissenschaftliche Journale:


Photochemical & Photobiological Sciences - published by The Royal Society of Chemistry -
PPS meets the growing information needs of scientists working in the areas of photochemistry and photobiology, and indeed, encourages a synergism between these two important research areas. This international journal is published monthly on behalf of the European Photochemistry Association (EPA), the European Society for Photobiology (ESP), the Asia and Oceania Society for Photobiology (AOSP) and the Korean Society of Photoscience (KSP), and is available in both print and electronic formats.

Photochemistry and Photobiology - published by Wiley-Interscience -
... publishes original research articles and reviews on current topics in photoscience.



Aktuelle wissenschaftliche Fachartikel der genannten Journale:


Negative impacts of Ultraviolet-A radiation on antioxidant and oxidative stress biomarkers of African catfish Clarias gariepinus

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00112A, Paper
Ahmed Th Ibrahim
The present study was carried out to evaluate the ultraviolet-A (UVA) effects on biochemical, oxidative stress and antioxidant changes using aquatic species. The destructive effects of Ultraviolet-A radiation on the...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 29 May 2015 | 1:00 am CEST

Estimating the Diurnal Cycle and Daily Insolation of Ultraviolet and Photosynthetically Active Radiation at the Sea Surface

Abstract

Accurate determination of the diurnal variability and daily insolation of surface (0+) and sub-surface (0-) irradiance are essential to estimate several physical, chemical and biological processes occurring at the surface layer of marine environments. Natural downwelling PAR and spectral UVR were examined on eight occasions at 0+ and 0- to refine empirical models, particularly in the UVR spectrum. The diurnal variability in UVR and PAR were wavelength dependent and were modelled by a sinusoidal equation. The best fit for PAR at 0+ and 0- was the sinusoid power of n = 2 and n = 2.5, respectively. In the UVR spectrum, sinusoids increased as wavelengths decreased ranging from n = 2 – 5. Higher n values in the UV-B spectrum suggest sharper increase/decrease near sunrise and sunset hours, ultimately reducing the final value of daily insolation at specified wavelengths. Calculated daily insolation of UV-B/(UV-A + PAR) ratio suggests that photo-inhibition from exposure to UV-B occurs within a shorter biologically effective day length than PAR, and is high during summer and low during winter. These results suggest that biogeochemical calculations based on diurnal models of irradiance measurements would benefit from accurate solar noon references and wavelength specificity, particularly in the UVR spectrum.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 28 May 2015 | 3:04 pm CEST

Effects of UV-C and Vacuum-UV TiO2 Advanced Oxidation Processes on the Acute Mortality of Microalgae

Abstract

Advanced oxidation processes/technologies (AOT) that combine a semiconductor, such as titanium dioxide (TiO2), with a UV source have been used to eliminate microorganisms in various water treatment applications. To facilitate the applicability of this technique, the gain in efficiency from the semiconductor compared to the UV source alone with respect to different target organisms requires evaluation. The primary objective of this study was to determine the effects of TiO2 and UV wavelength on a freshwater alga, Pseudokirchneriella subcapitata, and a marine alga, Tetraselmis suecica. For each species, dose-response experiments were conducted to determine the median lethal dose (LC50) of the following treatments: UV-light emitted with a peak of 254 nm, UV-light emitted with a peak of 254 nm in the presence of TiO2, and UV-light emitted with a peak of 254 nm and 185 nm in the presence of TiO2. In both species, the presence of TiO2 significantly increased mortality. Across all three treatments, P. subcapitata was more sensitive than T. suecica; moreover, the addition of the 185 nm wavelength significantly increased cell mortality in P. subcapitata but not in T. suecica.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 28 May 2015 | 2:55 pm CEST

Photophysics and Rotational Dynamics of a Hydrophilic Molecule in a Room Temperature Ionic Liquid

Abstract

We have studied the photophysics and rotational diffusion of hydrophilic solute 7-(N, N'diethylamino)coumarin-3-carboxylic acid (7-DCCA) in a room temperature ionic liquid methyltrioctylammonium bis(trifluoromethylsulfonyl) imide ([N1888][NTf2]). Comparison of activation energy of viscous flow and nonradiative decay shows that the photophysical properties of 7-DCCA are not guided by the bulk viscosity of the medium but dependent on the specific solute solvent interaction and structural heterogeneity of the medium. The rotational relaxation behaviour of 7-DCCA in [N1888][NTf2] shows significant deviation from the Stokes EinsteinDebye hydrodynamic model of rotational diffusion. This is indicative of the influence of specific solute solvent interaction on the rotational relaxation behaviour of 7-DCCA. Comparison of activation energy of rotational relaxation with activation energy of viscous flow clearly reinforces our assumption that the structural heterogeneity of the medium and specific solute solvent interaction plays a dominant role on the rotational diffusion instead of bulk viscosity.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 28 May 2015 | 2:52 pm CEST

Origins of the Intermediate Spectral Form in M100 Mutants of Photoactive Yellow Protein

Abstract

Numerous single-site mutants of photoactive yellow protein (PYP) from Halorhodospira halophila and as well as PYP homologs from other species exhibit a shoulder on the short wavelength side of the absorbance maximum in their dark-adapted states. The structural basis for the occurrence of this shoulder, called the “intermediate spectral form,” has only been investigated in detail for the Y42F mutation. Here we explore the structural basis for occurrence of the intermediate spectral form in a M121E derivative of a circularly permuted H. halophila PYP (M121E-cPYP). The M121 site in M121E-cPYP corresponds to the M100 site in wild-type H. halophila PYP. High-resolution NMR measurements with a salt-tolerant cryoprobe enabled identification of those residues directly affected by increasing concentrations of ammonium chloride, a salt that greatly enhances the fraction of the intermediate spectra form. Residues in the surface loop containing the M121E (M100E) mutation were found to be affected by ammonium chloride as well as a discrete set of residues that link this surface loop to the buried hydroxyl group of the chromophore via a hydrogen bond network. Localized changes in the conformational dynamics of a surface loop can thereby produce structural rearrangements near the buried hydroxyl group chromophore while leaving the large majority of residues in the protein unaffected.

Thumbnail image of graphical abstract

Mutations at the M100 site (large red ball) in photoactive yellow protein produce the intermediate spectral form (shoulder in the UV-Vis spectrum) by affecting a network of residues (cyan balls) including those that are H-bonded to the hydroxyl group of the chromophore (small red balls).

Quelle: Photochemistry and Photobiology | 28 May 2015 | 10:54 am CEST

Reviewing the relevance of fluorescence in biological systems

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00122F, Perspective
Maria Gabriela Lagorio, Gabriela Beatriz Cordon, Analia Iriel
Fluorescence is emitted by diverse living organisms. The analysis and interpretation of these signals may give information about their physiological state, ways of communication among species and presence of specific...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 May 2015 | 1:00 am CEST

T-cell mediated anti-tumor immunity after photodynamic therapy: Why does it not always work and how can we improve it?

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00455H, Perspective
Florian Anzengruber, Pinar Avci, LUcas de Freitas, Michael R Hamblin
Photodynamic therapy (PDT) uses the combination of non-toxic photosensitizers and harmless light to generate reactive oxygen species that destroy tumors by a combination of direct tumor cell killing, vascular shutdown...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 May 2015 | 1:00 am CEST

From Intra- to Intermolecular Hydrogen Bond with the Surrounding: Steady-State and Time-Resolved Behaviours

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00079C, Paper
Abderrazzak Douhal, Noemi Carmona Alarcos, Mario Gutierrez, Marta Liras, Felix Sanchez
We report on the photodynamics of 2-(2'-hydroxyphenyl)benzoxazole (HBO), compared to its amino derivatives 6-amino-2-(2'-hydroxypheny)benzoxazole (6A-HBO) and 5-amino-2-(2'-hydroxypheny)benzoxazole (5A-HBO) in N, N-dimethylformamide (DMF) solutions. HBO at S0 shows a reversible deprotonation...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 26 May 2015 | 1:00 am CEST

Coumarin Containing Star Shaped 4-arm Polyethylene glycol (PEG): Targeted Fluorescent Organic Nanoparticles for efficient dual treatment of Photodynamic therapy (PDT) and Chemotherapy

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00057B, Paper
Moumita Gangopadhyay, Tanya Singh, Krishna Kalyani Behara, Surendra Karwa, Sudip Ghosh, Pradeep N.D. Singh
Single component fluorescent organic polymeric nanoparticles (NPs) has been synthesized based on a star shaped 4-arm PEG containing coumarin chromophore for concomitant employment of Photodynamic therapy (PDT) and chemotherapy synergistically...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 26 May 2015 | 1:00 am CEST

Photochemical Degradation of the UV Filter Octyl Methoxycinnamate in Solution and in Aggregates

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00074B, Paper
Kerry M Hanson, Swathi Narayanan, Valerie M Nichols, Christopher J. Bardeen
The photodegradation of the ultraviolet (UV) filter octyl methoxycinnamate (OMC) is investigated in both dilute solution and in aggregated form. In dilute solution, the ratio of trans and cis isomers...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 26 May 2015 | 1:00 am CEST

The Synthesis and Photocatalytic Properties of TiO2 Nano-Tube Array by Starch Modified Anodic Oxidation

Abstract

In this study, the characterization and photocatalytic activity of TiO2 nanotube arrays prepared by anodization process with starch addition were investigated in detail. The results suggested that the optimum mass fraction of starch added in anodization process was 0.1 %, with which TiO2 nanotube arrays owning good tubular structure were synthesized. The tube length and average inner diameter of nanotubes were approximately 4 μm and 30 nm, respectively. Through the characterization of TiO2 nanotube arrays by energy dispersive spectrometer, scanning electron microscopy, transmission electron microscopy, X-ray diffraction, Fourier Transform Infrared (FTIR) spectroscopy, it was found that the as-prepared nanotubes possessed well uniformed and higher photo-degradation responsive than the pure TiO2. Moreover, it was expected that the as-prepared nanotubes exhibited good photocatalytic activity for the degradation of RhB under UV-light irradiation, which could be ascribed to their good morphology, enhanced UV-light absorption property and electron transmission ability during the photocatalytic reaction. In addition, the nanotubes was not significantly regenerated during the cycling runs experiment. Overall, this study could provide a principle method to synthesize TiO2 nanotube arrays with enhanced photocatalytic activity by anodization process with starch addition for environmental purification.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 23 May 2015 | 4:26 pm CEST

Solvent Viscosity Influence on the Chemiexcitation Efficiency of Inter and Intramolecular Chemiluminescence Systems

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00152H, Paper
Muhammad Khalid, Sergio Perreira Souza Jr., Luiz Franzisco M.L. Ciscato, Fernando Heering Bartoloni, Wilhelm Josef Baader
The effect of medium viscosity on the chemiexcitation quantum yields of the induced decomposition of 1,2-dioxetanes (highly efficient intramolecular CIEEL system) and the catalyzed decomposition of diphenoyl peroxide and a...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 22 May 2015 | 1:00 am CEST

How Does Photoreceptor UVR8 Perceive a UV-B Signal?

Abstract

UVR8 is the only known plant photoreceptor that mediates light responses to UV-B (280-315 nm) of the solar spectrum. UVR8 perceives a UV-B signal via light-induced dimer dissociation, which triggers a wide range of cellular responses involved in photo-morphogenesis and photo-protection. Two recent crystal structures of Arabidopsis thaliana UVR8 (AtUVR8) have revealed unusual clustering of UV-B-absorbing Trp pigments at the dimer interface and provided a structural framework for further mechanistic investigation. This review summarizes recent advances in spectroscopic, computational and crystallographic studies on UVR8 that are directed towards full understanding of UV-B perception at the molecular level.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 21 May 2015 | 3:43 pm CEST

Doping of Zinc Oxide with Selected First Row Transition Metals for Photocatalytic Applications

Abstract

ZnO doped with Cr, Mn, Fe, Co, Ni and Cu was prepared by homogeneous hydrolysis of sulphates with urea. The samples were annealed at various temperatures and characterized by X-ray powder diffraction, UV/VIS reflectance spectroscopy, BET (Brunauer-Emmet-Teller) surface area and porosity measurements. The photocatalytic activity of the samples was evaluated by measuring the degradation of an organic dye Reactive Black 5. The morphology of the samples was determined by scanning electron microscopy and atomic-force microscopy. For the Cu-doped ZnO sample, EPR spectra were obtained. All samples annealed at 800°C contained hexagonal ZnO. In the VIS region, the best photocatalytic performance had the ZnO samples doped with Cr, Fe and Cu.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 21 May 2015 | 2:03 pm CEST

Kinetic Model of Photoautotrophic Growth of Chlorella sp Microalga, Isolated from the Setúbal Lagoon

Abstract

In this work a kinetic expression relating light availability in the culture medium with the rate of microalgal growth is obtained. This expression, which is valid for low illumination conditions, was derived from the reactions that take part in the light-dependent stage of photosynthesis. The kinetic expression obtained is a function of the biomass concentration in the culture, as well as of the local volumetric rate of absorption of photons, and only includes two adjustable parameters. In order to determine the value of these parameters and to test the validity of the hypotheses made, autotrophic cultures of the Chlorella sp. strain were carried out in a modified BBM medium at three CO2 concentrations in the gas stream, namely 0.034%, 0.34% and 3.4%. Moreover, the local volumetric rate of photon absorption was predicted based on a physical model of the interaction of the radiant energy with the suspended biomass, together with a Monte Carlo simulation algorithm. The proposed intrinsic expression of the biomass growth rate, together with the Monte Carlo radiation field simulator, are key to scale up photobioreactors when operating under low irradiation conditions, independently of the configuration of the reactor and of its light source.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 21 May 2015 | 2:02 pm CEST

Synthesis and photophysical properties of photoactivable cationic porphyrin 5-(4-N-dodecylpyridyl)-10,15,20-tri(4-N-methylpyridyl)-21H,23H-porphyrin tetraiodide for anti malaria PDT

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00139K, Paper
Aurelie Stallivieri, Florent Le Guern, Regis Vanderesse, Dominique Meledje, Giulio Jori, Celine Frochot, Samir Acherar
This article describes a new synthetic method for obtaining three water soluble porphyrins. The more sophisticated porphyrin [5-(4-N-dodecylpyridyl)-10,15,20-tri(4-N-methylpyridyl)-21H,23H-porphyrin tetraiodide], also named C12 porphyrin, was obtained through a three steps methodology....
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 21 May 2015 | 1:00 am CEST

Vibronic Structures in Absorption and Fluorescence Spectra of Firefly Oxyluciferin in Aqueous Solutions

Abstract

To elucidate the factors determining the spectral shapes and widths of the absorption and fluorescence spectra for keto and enol oxyluciferin and their conjugate bases in aqueous solutions, the intensities of vibronic transitions between their ground and first electronic excited states were calculated for the first time via estimation of the vibrational Franck–Condon factors. The major normal modes, overtones and combination tones in absorption and fluorescence spectra are similar for all species. The theoretical full widths at half maximum of absorption spectra are 0.4–0.7 eV and those for the fluorescence spectra are 0.4–0.5 eV, except for phenolate-keto that exhibits exceptionally sharp peak widths due to the dominance of the 0–0′ or 0′–0 band. These spectral shapes and widths explain many relevant features of the experimentally observed spectra.

Thumbnail image of graphical abstract

The intensities of vibronic transitions for keto and enol oxyluciferin and their conjugate bases in aqueous solutions between their ground and first electronic excited states were calculated for the first time via estimation of the vibrational Franck–Condon factors. The theoretical spectral shapes and widths explain many relevant features of the experimentally observed spectra.

Quelle: Photochemistry and Photobiology | 20 May 2015 | 1:28 pm CEST

The Effect of Surface Charge Saturation On Heat-induced Aggregation of Firefly Luciferase

Abstract

We present here the effect of firefly luciferase surface charge saturation and the presence of some additives on its thermal-induced aggregation. Three mutants of firefly luciferase prepared by introduction of surface Arg residues named as 2R, 3R and 5R have two, three and five additional arginine residues substituted at their surface compared to native luciferase; respectively. Turbidimetric study of heat-induced aggregation indicates that all three mutants were reproducibly aggregated at higher rates relative to wild type in spite of their higher thermostability. Amongst them, 2R had most evaluated propensity to heat-induced aggregation. Therefore, the hydrophilization followed by appearing of more substituted arginine residues with positive charge on the firefly luciferase surface was not reduced its thermal aggregation. Nevertheless, at the same condition in the presence of charged amino acids, e.g., Arg, Lys and Glu, as well as a hydrophobic amino acid, e.g., Val, the heat-induced aggregation of wild type and mutants of firefly luciferases was markedly decelerated than those in the absence of additives. On the basis of obtained results it seems, relinquishment of variety in charge of amino acid side chains, they via local interactions with proteins cause to decrease rate and extent of their thermal aggregation.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 20 May 2015 | 9:51 am CEST

In vivo evaluation of photodynamic inactivation using Photodithazine[registered sign]against Candida albicans

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00368C, Paper
Ana Cl�udia Pavarina, Juliana Cabrini Carmello, Livia Nordi Dovigo, Ewerton G. de Oliveira Mima, Janaina Habib Jorge, Carlos Alberto de Souza Costa, Vanderlei Salvador Bagnato
This study describes the photoinactivation of Candida albicans in a murine model of oral candidosis, mediated by Photodithazine[registered sign] (PDZ). Six-week-old female Swiss mice were immunosuppressed, and inoculated with C albicans...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 20 May 2015 | 1:00 am CEST

Enhanced sunlight photocatalytic activity of Ag3PO4 decorated novel combustion synthesis derived TiO2 nanobelts for dye and bacterial degradation

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00092K, Paper
Neerugatti KrishnaRao Eswar, Praveen Ramamurthy, Giridhar Madras
This study demonstrates the synthesis of TiO2 nanobelts using solution combustion derived TiO2 with enhanced photocatalytic activity for dye degradation and bacterial inactivation. Hydrothermal treatment of combustion synthesized TiO2 resulted...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 20 May 2015 | 1:00 am CEST

Green Light to Plant Responses to Pathogens: the Role of Chloroplast Light-Dependent Signaling in Biotic Stress

Abstract

Light has a key impact on the outcome of biotic stress responses in plants by providing most of the energy and many signals for the deployment of defensive barriers. Within this context, chloroplasts are not only the major source of energy in the light; they also host biosynthetic pathways for the production of stress hormones and secondary metabolites, as well as reactive oxygen species and other signals which modulate nuclear gene expression and plant resistance to pathogens. Environmental, and in particular, light-dependent regulation of immune responses may allow plants to anticipate and react more effectively to pathogen threats. As more information is gathered, increasingly complex models are developed to explain how light and ROS signaling could interact with endogenous defense pathways to elicit efficient protective responses against invading microorganisms. The emerging picture places chloroplasts in a key position of an intricate regulatory network which involves several other cellular compartments. This article reviews current knowledge on the extent and the main features of chloroplast contribution to plant defensive strategies against biotic stress.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 19 May 2015 | 12:34 pm CEST

Solar Ultraviolet Radiation Exposure of South African Marathon Runners During Competition Marathon Runs and Training Sessions: A Feasibility Study

Abstract

Marathon runners spend considerable time in outdoor training for and participating in marathons. Outdoor runners may experience high solar ultraviolet radiation (UVR) exposure. South Africa, where running is popular, experiences high ambient solar UVR levels that may be associated with adverse health effects. This feasibility study explores the use of personal dosimeters to determine solar UVR exposure patterns and possible related acute health risks of four marathon runners during marathons and training sessions in Cape Town and Pretoria. Runners running marathons that started early in the day, and that did not exceed 4 hours, yielded low total solar UVR exposure doses (mean 0.093 SED per exposure period run, median 0.088 SED, range 0.062–0.136 SED; average of 16.54% of ambient solar UVR). Training sessions run during early morning and late afternoon presented similar results. Several challenges hindered analysis including accounting for anatomical position of personal dosimeter and natural shade. To assess health risks, hazard quotients (HQs) were calculated using a hypothetical runner's schedule. Cumulative, annual solar UVR exposure-calculated acute health risks were low (HQ = 0.024) for training sessions and moderate (HQ = 4.922) for marathon runs. While these data and calculations are based on 18 person-days, one can measure marathon runners' personal solar UVR exposure although several challenges must be overcome.

Thumbnail image of graphical abstract

Marathon runners spend considerable time outdoors training for and participating in marathons, and may experience high solar ultraviolet radiation (UVR) exposure. South Africa, where running is popular, experiences high UVR levels that may be associated with adverse health effects. This feasibility study explores use of personal dosimeters to determine solar UVR exposure patterns of four marathon runners during marathons and training sessions. Runners running marathons that started early in the day, and that did not exceed 4 h, yielded low total solar UVR exposure doses. Several challenges hindered analysis including accounting for anatomical position of personal dosimeter and natural shade.

Quelle: Photochemistry and Photobiology | 19 May 2015 | 12:11 pm CEST

Aminolevulinic acid dendrimers in photodynamic treatment of cancer and atheromatous disease

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00126A, Paper
Lorena Rodriguez, Pablo Vallecorsa, Sinan Battah, Gabriela Di Venosa, Gustavo Calvo, Leandro Mamone, Daniel Saenz, Marina Gonzalez, Alcira Batlle, Sandy MacRobert, Adriana Casas
The use of endogenous protoporphyrin IX after administration of 5-aminolaevulinic acid (ALA) has led to many applications in photodynamic therapy (PDT). We have previously reported that the conjugation of ALA...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 May 2015 | 1:00 am CEST

Sun exposure patterns of urban, suburban, and rural children. A dosimetry and diary study of 150 children.

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00052A, Paper
Mette Bodekaer, Bibi Petersen, Peter Alshede Philipsen, Jakob Heydenreich, Elisabeth Thieden, Hans Christian Wulf
Background: Sun exposure is the main etiology to skin cancer. Differences in skin cancer incidence have been observed between rural and urban populations. Objectives: As sun exposure begins in childhood;...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 18 May 2015 | 1:00 am CEST

Projected changes in erythemal and the vitamin D effective irradiance over northern-hemisphere high latitudes

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00093A, Paper
Ilias Fountoulakis, Alkis Bais
Simulations of monthly mean noon UV Index and the effective dose for the production of vitamin D in the human skin have been performed for local noon for the latitude...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 18 May 2015 | 1:00 am CEST

Ultraviolet B Inhibits Skin Wound Healing by Affecting Focal Adhesion Dynamics

Abstract

As the most important interface between human body and external environment, skin acts as an essential barrier preventing various environmental damages, among which DNA-damaging UV radiation from the sun remains the major environmental risk factor causing various skin diseases. It has been well documented that wavelengths in the ultraviolet B (UVB) radiation range (290–320 nm) of the solar spectrum can be absorbed by skin and lead to cutaneous injury and various other deleterious effects. During process such as wound healing, the orchestrated movement of cells in a particular direction is essential and highly regulated, integrating signals controlling adhesion, polarity and the cytoskeleton. Cell adhesion and migration are modulated through both of actin and microtubule cytoskeletons. However, little was known about how UVB affects skin wound healing and migration of epidermal keratinocytes. Here, we demonstrate that UVB can delay the wound healing progress in vivo with a murine model of full-thickness skin wound. In addition, UVB significantly inhibited keratinocyte motility by altering focal adhesion turnover and cytoskeletal dynamics. Our results provide new insights into the etiology of UVB exposure-induced skin damages.

Thumbnail image of graphical abstract

Skin is the most important barrier protecting us from various environmental damages such as DNA-damaging UV radiation from the sun. Little was known about how UVB affects skin wound healing and migration of epidermal keratinocytes. The aim of this work is to estimate the effects of UVB on keratinocyte cell motility, focal adhesion turnover, cytoskeletal dynamics and skin wound healing both in vitro and in vivo mouse model.

Quelle: Photochemistry and Photobiology | 16 May 2015 | 7:17 am CEST

Phototherapeutic Effect of Low-Level Laser on Thyroid Gland of Gamma Irradiated Rats

Abstract

One inescapable feature of life on the earth is exposure to ionizing radiation. The thyroid gland is one of the most sensitive organs to gamma-radiation and endocrine disrupters. Low level laser therapy (LLLT) has been used to stimulate tissue repair, and reduce inflammation. The aim of this study was to gauge the value of using Helium-Neon laser to repair the damaged tissues of thyroid gland after gamma-irradiation. Albino rats were used in this study (144 rat), divided into control, gamma, laser, and gamma plus laser irradiated groups, each group was divided into 6 subgroups according to time of treatment (total 6 sessions). Rats were irradiated once with gamma radiation (6 Gy), and an external dose of laser [Wavelength 632.8 nm, 12 mW, CW, Illuminated area 5.73 cm2, 2.1 mW/cm2, 120 sec, 1.4 J, 0.252 J/cm2] twice weekly localized on thyroid region of the neck, for a total of six sessions. Animals were sacrificed after each session. Analysis included thyroid function, oxidative stress markers, liver function and blood picture. Results revealed improvement in thyroid function, liver function and antioxidant levels, and the blood cells count after LLLT.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 14 May 2015 | 4:40 pm CEST

Hybrid Membrane of Agarose and Lanthanide Coordination Polymer: a Selective and Sensitive Fe3+ Sensor

Abstract

A new hybrid membrane was prepared by a facile method based on a highly luminescent lanthanide coordination polymer and agarose. The soft membrane was characterized by FT-IR, PXRD, SEM and luminescence. It is found that the soft membrane is a highly selective and sensitive sensor, among 19 metal ion solutions of Fe3+, Mg2+, Li+, Ca2+, Zn2+, Cu2+, Ba2+, Mn2+, Ru3+, Cr3+, Ag+, Sr2+, Cd2+, Na+, Ni2+, Pb2+, Fe2+, Hg2+ and Ca2+, only Fe3+ quench the luminescence. The sensing results can be distinguished by the naked eye in daylight or by irradiation of a portable UV light at the scene. Mechanism studies reveal the sensing is due to the decomposition of the coordination polymer 1 which induced by slow permeation of Fe3+. Further studies found anions of inline image, inline image, inline image, Br, Cl, inline image, inline image, I, inline image and inline image will not quench the luminescence of the hybrid membrane, which imply that other anions in water would not disturb the detection result.

Thumbnail image of graphical abstract

A new hybrid membrane was prepared by a facile method. It is a highly selective and sensitive Fe3+ sensor. The sensing results can be easily distinguished by the naked eye in daylight or irradiated by a portable UV device.

Quelle: Photochemistry and Photobiology | 14 May 2015 | 7:24 am CEST

Quinone-Bodipy H-bonding interaction over [small pi]-stacking in toluene

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00035A, Paper
Animesh Karmakar, Soumyaditya Mula, Kalyan Ghosh, Tandrima Chaudhuri, Neelam Shivran, Manas Banerjee, Subrata Chattopadhyay
Quinone type compounds (o-chloranil, p-chloranil and DDQ) demonstrate excellent H-bonding interactions with a meso-phenol Bodipy dye (1) in both ground and excited state in a non-polar toluene medium.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 May 2015 | 1:00 am CEST

Minimizing Concentration of Sodium Hypochlorite in Root Canal Irrigation by Combination of Ultrasonic Irrigation with Photodynamic Treatment

Abstract

Concentration of sodium hypochlorite (NaOCl) is positively correlated with its effectiveness in root canal disinfection but negatively correlated with its biocompatibility. The objective of this in vitro study was to compare the bactericidal effects among ultrasonic irrigation with different concentration of NaOCl alone or together with photodynamic treatment (PDT) against Enterococcus faecalis (E. faecalis) in infected root canals. One hundred and twenty bovine root canals contaminated with E. faecalis were randomly distributed into 12 groups treated with different disinfection methods: PDT, ultrasonic irrigation with NaOCl at different concentrations (0.5%, 1.0%, 2.0%, 2.5% and 5.25%), and ultrasonic irrigation with NaOCl at different concentrations plus PDT. Data of microorganism load were collected before and after disinfection and analyzed by one-way ANOVA and LSD tests. Significantly enhanced antibacterial effects were noticed in groups treated by PDT plus 2.0% or 2.5% NaOCl irrigation (P < 0.05). No statistical differences existed in bactericidal efficacy among groups of PDT plus ultrasonic irrigation with 2.0%, 2.5% or 5.25% NaOCl, and ultrasonic irrigation with 5.25% NaOCl alone (> 0.05). Our study confirmed the feasibility to reduce the concentration of NaOCl to a safer level while maintaining its antibacterial efficiency through synergistic effect of PDT with NaOCl ultrasonic irrigation.

Thumbnail image of graphical abstract

Enterococcus faecalis plays an important role in root canal treatment failures and persistent periapical infection. The results of this in vitro study confirmed the feasibility to reduce the concentration of NaOCl to a safer level while maintaining its antibacterial efficiency through synergistic effect of PDT with NaOCl ultrasonic irrigation.

Quelle: Photochemistry and Photobiology | 11 May 2015 | 6:04 am CEST

Determination of pyruvic acid concentration using a bioluminescence system from Photobacterium leiognathi

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00118H, Paper
Guanhua Xuan, Xiaodong Lu, Jingxue Wang, Hong Lin, Huihui Liu
A novel method combining LDH catalysis with a bacterial bioluminescence system was developed for pyruvic acid detection. The detection system was expected to be an attractive substitute technology because of its rapidity, low cost and operational ease.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 11 May 2015 | 1:00 am CEST

Promotion of Proapoptotic Signals by Lysosomal Photodamage

Abstract

We previously reported that low-level lysosomal photodamage enhanced the efficacy of subsequent mitochondrial photodamage, resulting in a substantial promotion of apoptotic cell death. We now extend our analysis of the sequential PDT protocol to include two additional lysosomal-targeting photosensitizers. These agents, because of enhanced permeability, are more potent than the agent (N-aspartyl chlorin E6, NPe6) used in the initial study. Addition of the cell-permeable cysteine protease inhibitor E-64d and calcium chelator BAPTA-AM almost completely suppressed sequential PDT-induced loss of mitochondrial membrane potential and activation of procaspases-3 and -7. These inhibitors did not, however, suppress the proapoptotic effect of a BH3 mimetic or mitochondrial photodamage. Knockdowns of ATG7 or ATG5, proteins normally associated with autophagy, suppressed photodamage induced by the sequential PDT protocol. These effects appear to be independent of the autophagic process as pharmacological inhibition of autophagy offered no such protection. Effects of ATG7 and ATG5 knockdowns may reflect the role that ATG7 plays in regulating lysosome permeability, and the likelihood that a proteolytic fragment of ATG5 amplifies mitochondrial proapoptotic processes. Our results suggest that low-dose photodamage that sequentially targets lysosomes and mitochondria may offer significant advantages over the use of single photosensitizers.

Thumbnail image of graphical abstract

Dose–response curves showing the ability of a prior low level of lysosomal photodamage (NPe6) to markedly potentiate photokilling by the benzoporphyrin derivative (BPD).

Quelle: Photochemistry and Photobiology | 8 May 2015 | 1:42 pm CEST

Photocatalytic water disinfection by simple and low-cost monolithic and heterojunction ceramic wafers

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00002E, Paper
Neel M. Makwana, Rachael Hazael, Paul F. McMillan, Jawwad A. Darr
Ceramic wafers prepared by a simple, low-cost method, are investigated for photocatalytic water disinfection. Heterojunction wafers were able to sustain the formation of charged species responsible for bacterial inactivation.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 May 2015 | 1:00 am CEST

Conjugation of photosensitisers to antimicrobial peptides increases the efficiency of photodynamic therapy in cancer cells

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00038F, Paper
Francesca Moret, Marina Gobbo, Elena Reddi
Antimicrobial peptides (magainin, buforin, and apidaecin) are useful tools for increasing the cellular uptake and photodynamic efficiency of photosensitizers.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 May 2015 | 1:00 am CEST

A modeling approach to determine how much UV radiation is available across the UK and Ireland for health risk and benefit studies

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00008D, Paper
Andreas Kazantzidis, Andrew Smedley, Richard Kift, John Rimmer, Jacqueline L. Berry, Lesley E. Rhodes, Ann R. Webb
Monthly average vitamin D effective UV doses (J m-2) over UK based on data for years 2003-2012. The southern part receives 1.5-2 times more UV than the north during spring, summer and autumn. Doses at coastal sites being up to 25% higher than inland areas.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 6 May 2015 | 1:00 am CEST

Folic acid-conjugated TiO2-doped mesoporous carbonaceous nanocomposites loaded with Mitoxantrone HCl for chemo-photodynamic therapy

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00097A, Paper
Zhi Li, Ya Ou-Yang, Yang Liu, Yi-Qiu Wang, Xia-Li Zhu, Zhen-Zhong Zhang
A TiO2-doped porous carbon drug delivery system was prepared. The ability of this system to combine chemotherapy with photodynamic activity enhanced the cancer cell killing effect.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 6 May 2015 | 1:00 am CEST

Hair follicle melanocyte precursors are awoken by ultraviolet radiation via a cell extrinsic mechanism

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00098J, Paper
Blake Ferguson, Takahiro Kunisada, Hitomi Aoki, Herlina Y. Handoko, Graeme J. Walker
Melanocyte stem cells in the hair follicle respond to UVR-induced damage by dividing and migrating upwards into the epidermis. This effect is driven by paracrine signals from epidermal keratinocytes induced by adaptive changes in the skin resulting from multiple UVR exposures.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 5 May 2015 | 1:00 am CEST

Light-mediated DNA Repair Prevents UVB-induced Cell Cycle Arrest in Embryos of the Crustacean Macrobrachium olfersi

Abstract

High levels of ultraviolet-B (UVB) radiation can negatively affect aquatic animals. Macrobrachium olfersi is a prawn that lives in clear freshwaters and during the breeding season, females carry eggs in an external brood pouch. Therefore, we hypothesize that eggs are also exposed to environmental UVB radiation. The aim of this study was to investigate whether UVB radiation induces DNA damage and compromises cell cycle in embryos of M. olfersi. In laboratory, UVB irradiance (310 mW. cm−2) that embryos receive in the natural environment was simulated. After irradiation, embryos were kept under different light conditions in order to recognize the presence of cell repair. UVB radiation induces DNA damage, specifically thymine dimers. After 48 h of UVB exposure, a significant decrease in the level of these dimers was observed in embryos kept under visible light while it remained constant in the dark. Moreover, under visible light and darkness, a decrease in proliferation was observed after 48 h of irradiation. An increase in PCNA expression and decrease in p53 expression were observed after, respectively, 1 and 48 h of exposure. Our results showed that UVB radiation disturbs the cell cycle and induces DNA damage in M. olfersi embryos. However, under visible light these embryos showed successful DNA repair.

Thumbnail image of graphical abstract

In this paper, we simulated in laboratory the UVB irradiance that embryos receive in the natural environment. After irradiation, embryos were kept under different visible light conditions in order to recognize the presence of cell damage repair. In summary, our results showed that UVB radiation negatively impacts embryos of M. olfersi. The impairments observed in proliferation probably resulted from unrepaired DNA damage, which was responsible for the overexpression in darkness of p53 after 48 h and PCNA after 1 h. Moreover, in this study we demonstrated that, under visible light, embryos showed successful DNA repair.

Quelle: Photochemistry and Photobiology | 4 May 2015 | 7:02 am CEST

An Optimized Firefly Luciferase Bioluminescent Assay for the Analysis of Free Fatty Acids

Abstract

A firefly luciferase (LUC)-based bioluminescent assay for total free fatty acids (FFA) is presented. It is based on LUC's capability of converting FFA into fatty acyl-adenylates with consumption of adenosine 5′-triphosphate (ATP). Since ATP is a cosubstrate in LUC's bioluminescent reaction, together with firefly d-luciferin (d-LH2) and atmospheric oxygen (O2), any reduction in the assay's ATP content will lead to a decrease in the bioluminescent signal, which is proportional to the amount of FFA. Using FFA mixtures containing myristic (14:0), palmitic (16:0), stearic (18:0), oleic (18:1) and arachidonic acid (20:4) in ethanol, the assay was optimized through statistical experimental design methodology, namely fractional factorial (screening) and central composite (optimization) designs. The optimized method requires 2 μL of sample per tube in a final reaction volume of 50 μL. It is linear in the concentration range from 1 to 20 μm, with limits of detection (LOD) and quantitation (LOQ) of 1.3 and 4.5 μm, respectively. The method proved to be simple to perform, demands low reagent volumes, it is sensitive and robust and may be adapted to high-throughput screening.

Thumbnail image of graphical abstract

An optimized bioluminescent assay for free fatty acids is herein presented. The method is based on ATP depletion followed by bioluminescence detection. Optimization was achieved through experimental design methodology. The method is linear from 1 to 20 μm, with limits of detection and quantitation of 1.3 and 4.5 μm, respectively. The method is fast, simple to perform, sensitive and robust.

Quelle: Photochemistry and Photobiology | 4 May 2015 | 6:35 am CEST

Subtle structural changes in octupolar merocyanine dyes influence the photosensitized production of singlet oxygen

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00080G, Paper
Mikkel Bregnhoj, Frederico M. Pimenta, Yevgen M. Poronik, Daniel T. Gryko, Peter R. Ogilby
The photophysical properties of two indoline-based octupolar merocyanine dyes and of the corresponding quinoline-based dyes were examined.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 29 Apr 2015 | 1:00 am CEST

Vitamin D and Skin Cancer

Quelle: Photochemistry and Photobiology | 27 Apr 2015 | 11:40 am CEST

Kasha – Memories

Thumbnail image of graphical abstract

Michael Kasha (1921–2013) inspiring scientist and teacher, in recognition of his enormous scientific contributions and his influence in stimulating research in photophysics and photochemistry.

Quelle: Photochemistry and Photobiology | 27 Apr 2015 | 11:40 am CEST

Protein profiles of Escherichia coli and Staphylococcus warneri are altered by photosensitization with cationic porphyrins

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00194J, Paper
Eliana Alves, Ana Cristina Esteves, Antonio Correia, Angela Cunha, Maria A. F. Faustino, Maria G. P. M. S. Neves, Adelaide Almeida
Photosensitization of Gram(-)negative and Gram(+)-positive bacteria with cationic porphyrins induces overall protein degradation, revealed by SDS-PAGE, the tricationic one being extremely effective in degrading most bacterial proteins with low light doses.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Apr 2015 | 1:00 am CEST

A critical approach toward resonance-assistance in the intramolecular hydrogen bond interaction of 3,5-diiodosalicylic acid: a spectroscopic and computational investigation

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00033E, Paper
Bijan K. Paul, Narayani Ghosh, Ramakanta Mondal, Saptarshi Mukherjee
The photophysics and partial covalency in the intramolecular H-bond of 3,5-DISA are addressed from spectroscopic and advanced quantum chemical computational approaches.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 17 Apr 2015 | 1:00 am CEST

On the Dual Phosphorescence of Xanthone and Chromone in Glassy Hydrocarbon Hosts

Abstract

Trace quantities of hydrogen-bonding impurities in otherwise highly purified and dried glassy hydrocarbon matrices at 77 K can modify the relative triplet state energy levels, and hence the photophysical properties of two aromatic ketones, xanthone and chromone, to the extent that the intrinsic spectroscopic properties are obscured. The intrinsic spectroscopic properties of each are revealed in multicrystalline n-alkane Shpol'skii matrices, and also can be observed in rigorously purified and dried hydrocarbon glasses at 77 K. The extreme sensitivity to stoichiometric, and even substoichiometric quantities of hydrogen-bonding impurities arises from the near-degeneracy of the two lowest-lying triplet states, and the sensitive nature of the n[RIGHTWARDS ARROW]π* blueshift phenomena to specific hydrogen-bonding interactions.

Thumbnail image of graphical abstract

Trace quantities of hydrogen-bonding impurities in otherwise highly purified and dried glassy hydrocarbon matrices at 77 K modify the relative triplet state energy levels, and hence the photophysical properties of two aromatic ketones, xanthone and chromone, to the extent that the intrinsic spectroscopic properties are obscured. The intrinsic spectroscopic properties of each are revealed in multicrystalline n-alkane Shpol'skii matrices, and also in rigorously purified and dried hydrocarbon glasses at 77 K. The extreme sensitivity to substoichiometric quantities of hydrogen-bonding impurities arises from the near-degeneracy of the two lowest-lying triplet states, and the sensitive nature of the n[RIGHTWARDS ARROW]π* blueshift phenomena to specific hydrogen-bonding interactions.

Quelle: Photochemistry and Photobiology | 11 Apr 2015 | 6:52 am CEST

Utilization of PARAFAC-Modeled Excitation-Emission Matrix (EEM) Fluorescence Spectroscopy to Identify Biogeochemical Processing of Dissolved Organic Matter in a Northern Peatland

Abstract

In this study, we contrast the fluorescent properties of dissolved organic matter (DOM) in fens and bogs in a Northern Minnesota peatland using excitation emission matrix fluorescence spectroscopy with parallel factor analysis (EEM-PARAFAC). EEM-PARAFAC identified four humic-like components and one protein-like component and the dynamics of each were evaluated based on their distribution with depth as well as across sites differing in hydrology and major biological species. The PARAFAC-EEM experiments were supported by dissolved organic carbon measurements (DOC), optical spectroscopy (UV-Vis), and compositional characterization by ultrahigh resolution Fourier transform ion cyclotron resonance mass spectroscopy (FT-ICR MS). The FT-ICR MS data indicate that metabolism in peatlands reduces the molecular weights of individual components of DOM, and oxygen-rich less aromatic molecules are selectively biodegraded. Our data suggest that different hydrologic and biological conditions within the larger peat ecosystem drive molecular changes in DOM, resulting in distinctly different chemical compositions and unique fluorescent fingerprints. PARAFAC modeling of EEM data coupled with ultrahigh resolution FT-ICR MS has the potential to provide significant molecular-based information on DOM composition that will support efforts to better understand the composition, sources, and diagenetic status of DOM from different terrestrial and aquatic systems.

Thumbnail image of graphical abstract

Spectral characteristics of five components of Dissolved Organic Matter (DOM) in Glacial Lake Agassiz peatland porewaters identified by PARAFAC modeling of EEM fluorescence spectra. Color contours reflect intensities expressed in Quinine Sulfate Equivalent (QSE) units; blue low, red high. The relative loadings of these components to total fluorescence vary as a function of peat type and depth, and appear to be a function of the quality of the DOM and the active microbial community present.

Quelle: Photochemistry and Photobiology | 9 Apr 2015 | 6:47 am CEST

Photo and Chemical Reduction of Copper onto Anatase-Type TiO2 Nanoparticles with Enhanced Surface Hydroxyl Groups as Efficient Visible Light Photocatalysts

Abstract

In this study, the photocatalytic efficiency of anatase-type TiO2 nanoparticles synthesized using the sol–gel low-temperature method, were enhanced by a combined process of copper reduction and surface hydroxyl groups enhancement. UV–light-assisted photo and NaBH4-assisted chemical reduction methods were used for deposition of copper onto TiO2. The surface hydroxyl groups of TiO2 were enhanced with the assistance of NaOH modification. The prepared catalysts were immobilized on glass plates and used as the fixed-bed systems for the removal of phenazopyridine as a model drug contaminant under visible light irradiation. NaOH-modified Cu/TiO2 nanoparticles demonstrated higher photocatalytic efficiency than that of pure TiO2 due to the extending of the charge carriers lifetime and enhancement of the adsorption capacity of TiO2 toward phenazopyridine. The relationship of structure and performance of prepared nanoparticles has been established by using various techniques, such as XRD, XPS, TEM, EDX, XRF, TGA, DRS and PL. The effects of preparation variables, including copper content, reducing agents rate (NaBH4 concentration and UV light intensity) and NaOH concentration were investigated on the photocatalytic efficiency of NaOH-modified Cu/TiO2 nanoparticles.

Thumbnail image of graphical abstract

The visible–light-induced photocatalytic activity of anatase-type TiO2 nanoparticles was enhanced by a combined process of copper reduction and surface hydroxyl groups enhancement.

Quelle: Photochemistry and Photobiology | 8 Apr 2015 | 10:51 am CEST

Effects of Silencing Heme Biosynthesis Enzymes on 5-Aminolevulinic Acid-mediated Protoporphyrin IX Fluorescence and Photodynamic Therapy

Abstract

Aminolevulinic acid (ALA)-mediated protoporphyrin IX (PpIX) production is being explored for tumor fluorescence imaging and photodynamic therapy (PDT). As a prodrug, ALA is converted in heme biosynthesis pathway to PpIX with fluorescent and photosensitizing properties. To better understand the role of heme biosynthesis enzymes in ALA-mediated PpIX fluorescence and PDT efficacy, we used lentiviral shRNA to silence the expression of porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD) and ferrochelatase (FECH) in SkBr3 human breast cancer cells. PBGS and PBGD are the first two cytosolic enzymes involved in PpIX biosynthesis, and FECH is the enzyme responsible for converting PpIX to heme. PpIX fluorescence was examined by flow cytometry and confocal fluorescence microscopy. Cytotoxicity was assessed after ALA-mediated PDT. Silencing PBGS or PBGD significantly reduced ALA-stimulated PpIX fluorescence, whereas silencing FECH elevated basal and ALA-stimulated PpIX fluorescence. However, compared with vector control cells, the ratio of ALA-stimulated fluorescence to basal fluorescence without ALA was significantly reduced in all knockdown cell lines. PBGS or PBGD knockdown cells exhibited significant resistance to ALA-PDT, while increased sensitivity to ALA-PDT was found in FECH knockdown cells. These results demonstrate the importance of PBGS, PBGD and FECH in ALA-mediated PpIX fluorescence and PDT efficacy.

Thumbnail image of graphical abstract

Three heme biosynthesis enzymes porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD) and ferrochelatase (FECH) were silenced to evaluate its effects on aminolevulinic acid (ALA)-mediated protoporphyrin IX (PpIX) fluorescence and photodynamic therapy (PDT) in human breast cancer SkBr3 cells. Knockdown of PBGS or PBGD significantly decreased ALA-PpIX fluorescence and rendered resistance to PDT. In contrast, silence of FECH greatly sensitized cells to PDT by increasing ALA-PpIX production.

Quelle: Photochemistry and Photobiology | 8 Apr 2015 | 9:51 am CEST

Effects of Enhanced UV-B Radiation on Biochemical Traits in Postharvest Flowers of Medicinal Chrysanthemum

Abstract

This article reported UV-B radiation effects on biochemical traits in postharvest flowers of chrysanthemum. The experiment included six levels of UV-B radiation (UV0, 0 μW cm−2; UV50, 50 μW cm−2; UV200, 200 μW cm−2; UV400, 400 μW cm−2; UV600, 600 μW cm−2 and UV800, 800 μW cm−2). Enhanced UV-B radiation significantly increased hydrogen peroxide content (except for UV50), but did not evidently affect malondialdehyde content in flowers. Chlorophyll b and total chlorophyll content were significantly increased by UV600 and UV800. UV400 and UV600 significantly increased anthocyanins, carotenoids and UV-B absorbing compounds content, and the activities of phenylalanine ammonia lyase (PAL) and cinnamic acid-4-hydroxylase (C4H) over the control. 4-coumarate CoA ligase (4CL) activity was significantly decreased by enhanced UV-B radiation (except for UV50). The relationships between UV-B radiation intensities and the activities of secondary metabolism enzymes were best described by a second-order polynomial. The R2 values for UV-B radiation intensities and the activities of PAL, C4H and 4CL were 0.8361, 0.5437 and 0.8025, respectively. The results indicated that enhanced UV-B radiation could promote secondary metabolism processes in postharvest flowers, which might be beneficial for the accumulation of medically active ingredients in medicinal plants. The optimal UV-B radiation intensities in the study were between UV400-UV600.

Thumbnail image of graphical abstract

This article mainly studied enhanced UV-B radiation effects on biochemical traits in postharvest flowers of chrysanthemum. The experiment included six levels of UV-B radiation (UV0, 0 μW cm−2; UV50, 50 μW cm−2; UV200, 200 μW cm−2; UV400, 400 μW cm−2; UV600, 600 μW cm−2 and UV800, 800 μW cm−2). The results indicated that UV-B effects on biochemical traits in postharvest flowers depended on UV-B radiation intensities, and enhanced UV-B radiation could promote secondary metabolism processes in postharvest flowers.

Quelle: Photochemistry and Photobiology | 6 Apr 2015 | 7:24 am CEST

Photodegradation of Hydrophobic Pyridineketoximes in Toluene and Heptane

Abstract

The goal of the research was to study the reactivity of the hydrophobic 2- and 3-pyridineketoximes under exposure to UV-VIS light. The photodegradation was conducted in both toluene and heptane for 10 h under atmosphere of argon. Ten-hour irradiation experiments demonstrated that the pyridineketoximes underwent the facile E-Z photoisomerization, photo-Beckmann rearrangement, and to a lesser extent, the photosubstitution to the pyridine ring. From LC-MS and NMR analysis of the irradiated solutions, it was found that the photosubstitution proceeded to give the corresponding 6-substituted 2- or 3-pyridylketoxime via the replacement of the ring hydrogen by the benzyl or heptyl group. The photo-Beckmann rearrangement led to the formation of the corresponding amides, but also other products formed in the photo-decomposition reaction.

Thumbnail image of graphical abstract

This study presents the photochemical reactivity of the hydrophobic 2- and 3- pyridineketoximes – (Z)-oxime of 1-(2-pyridyl)tridecan-1-one and (E)-oxime of 1-(3-pyridyl)tridecan-1-one – in toluene and heptane as solvent. The data indicated that the both oximes underwent significant E-Z photoisomerization, photo-Beckmann rearrangement and the photosubstitution to the pyridine ring. For example, in aliphatic solvent, the photo-Beckmann rearrangement of (Z)-oxime of 1-(2-pyridyl)tridecan-1-one led to the formation of 2-aminopyridine, eicosan-8-one and N-dodecylpyridine-2-carboxamide. In the case of (E)-oxime of 1-(3-pyridyl)tridecan-1-one, the photodegradation led to formation of N-dodecylpyridine-3-carboxamide, 3-aminopyridine and eicosan-8-one.

Quelle: Photochemistry and Photobiology | 6 Apr 2015 | 7:03 am CEST

Effects of PAR and UV Radiation on the Structural and Functional Integrity of Phycocyanin, Phycoerythrin and Allophycocyanin Isolated from the Marine Cyanobacterium Lyngbya sp. A09DM

Abstract

An in vitro analysis of the effects of photosynthetically active and ultraviolet radiations was executed to assess the photostability of biologically relevant pigments phycocyanin (PC), phycoerythrin (PE) and allophycocyanin (APC) isolated from Lyngbya sp. A09DM. Ultraviolet (UV) irradiances significantly affected the integrity of PC, PE and APC; however, PAR showed least effect. UV radiation affected the bilin chromophores covalently attached to phycobiliproteins (PBPs). Almost complete elimination of the chromophore bands associated with α- and β-subunit of PE and APC occurred after 4 h of UV-B exposure. After 5 h of UV-B exposure, the content of PC, PE and APC decreased by 51.65%, 96.8% and 96.53%, respectively. Contrary to PAR and UV-A radiation, a severe decrease in fluorescence of all PBPs was observed under UV-B irradiation. The fluorescence activity of extracted PBP was gradually inhibited immediately after 15–30 min of UV-B exposure. In comparison to the PC, the fluorescence properties of PE and APC were severely lost under UV-B radiation. Moreover, the present study indicates that UV-B radiation can damage the structural and functional integrity of phycobiliproteins leading to the loss of their ecological and biological functions.

Thumbnail image of graphical abstract

UV irradiances significantly affected the structural and functional integrity of biologically relevant molecules phycocyanin (PC, λmax: 615 nm), phycoerythrin (PE, λmax: 563 nm) and allophycocyanin (APC, λmax: 652 nm). UV radiation also affected the bilin chromophores covalently attached to phycobiliproteins (PBPs). The spectroscopic as well as sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) analyses of the PC, PE and APC of Lyngbya sp. showed a marked decrease in the PBPs content with an increase in UV exposure time. In comparison to the PC, the fluorescence properties of PE and APC were severely lost under UV-B radiation.

Quelle: Photochemistry and Photobiology | 2 Apr 2015 | 12:02 pm CEST

Susceptibility of Ureaplasma urealyticum to Methylene Blue-Mediated Photodynamic Antimicrobial Chemotherapy: An in vitro Study

Abstract

The aim of this study was to detect the susceptibility of Ureaplasma urealyticum to methylene blue-mediated photodynamic antimicrobial chemotherapy (PACT). Three U. urealyticum strains including the standard serotype 1 and 5, and a clinically collected strain were used in this study. Strains were first incubated in 96-well culture plates in the presence of methylene blue with decreasing concentrations (from 1 to 0.015625 mg mL−1) for 20 or 60 min, and then submitted to irradiation with a light-emitting diode laser with a power density of 100 mW cm−2 for 8, 17, 34 or 68 min. Regrowth of the strains was performed soon after irradiation. A significant inactivation effect was observed after PACT. Longer incubation time induced more extensive inactivation of U. urealyticum. No difference in response to PACT was observed between the two biovars of U. urealyticum. It was concluded that PACT had a significant inactivation effect on U. urealyticum, and it might be a promising alternative treatment for resistant U. urealyticum infections.

Thumbnail image of graphical abstract

This work investigated the susceptibility of Ureaplasma urealyticum to methylene blue-mediated photodynamic antimicrobial chemotherapy (PACT). When U. urealyticum strains were incubated with methylene blue for 20 or 60 min, irradiation with 633 nm red light led to a significant inactivation effect on the growth of U. urealyticum. Higher light dose, or longer incubation time with methylene blue induced more extensive inactivation of U. urealyticum. Thus, PACT provides a promising alternative treatment for resistant U. urealyticum infections.

Quelle: Photochemistry and Photobiology | 2 Apr 2015 | 12:01 pm CEST

Photosensitizing Activity of Endogenous Eye Lens Chromophores: An Attempt to Unravel Their Contributions to Photo-Aging and Cataract Disease

Abstract

UVA-visible light has been proposed as a risk factor in the photo-aging of the human eye lens, as well as in the etiology of cataract disease. There is accumulating evidence indicating that photosensitizing reactions mediated by endogenous chromophores, which are generated during human eye lens aging, can play an important role in the generation of these processes. These reactions can lead to protein impairment by inducing non-enzymatic post-translational modifications such as protein oxidation and crosslinking. Although numerous chromophores have been characterized as both bound to human eye lens proteins and as unbound low-molecular-mass compounds, their contribution to eye lens photoaging and cataract disease is not completely understood. In this article we discuss the photochemical contribution of UV-filters derived from tryptophan catabolism and advanced glycation end products (AGEs) to human eye lens aging and cataract disease. We also discuss the recently described photosensitizing capacity of chromophores derived from newly discovered glucose and ascorbate degradation as a parallel pathway to their role in AGEs generation.

Thumbnail image of graphical abstract

Human eye lens aging is accompanied with the generation of numerous chromophores, which can be found at higher concentrations in cataractous lenses. In this review we discuss the presence and UVA-visible photosensitizing capacity of the main families of chromophores associated with the etiology and progression of human cataract disease.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:57 am CET

Improved Spectral Coverage and Fluorescence Quenching in Donor–acceptor Systems Involving Indolo[3-2-b]carbazole and Boron-dipyrromethene or Diketopyrrolopyrrole

Abstract

A novel π-conjugated triad and a polymer incorporating indolo[3,2-b]-carbazole (ICZ) and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) were synthesized via a Sonogashira coupling. Compared to the parent BODIPY the absorption and fluorescence spectrum were for both compounds broader and redshifted. The redshift of the fluorescence and the decrease of the fluorescence quantum yield and decay time upon increasing solvent polarity were attributed to the formation of a partial charge-transfer state. Upon excitation in the ICZ absorption band the ICZ fluorescence was quenched in both compounds mainly due to energy transfer to the BODIPY moiety. In a similar ICZ–π–DPP polymer (where DPP is diketopyrrolopyrrole), a smaller redshift of the absorption and fluorescence spectra compared to the parent DPP was observed. A less efficient quenching of the ICZ fluorescence in the ICZ–π–DPP polymer could be related to the unfavorable orientation of the transition dipoles of ICZ and DPP. The rate constant for energy transfer was for all compounds an order of magnitude smaller than predicted by Förster theory. While in a solid film of the triad a further redshift of the absorption maximum of nearly 100 nm was observed, no such shift was observed for the ICZ–π–BODIPY polymer.

Thumbnail image of graphical abstract

We report synthesis and studies of organic compounds incorporating indolo[3,2-b]-carbazole (ICZ), and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) or diketopyrrolopyrrole (DPP). The spectroscopic studies suggest stronger interaction between ICZ and BODIPY in both ground and excited states as well as more efficient energy transfer from ICZ to BODIPY, compared to those of the ICZ-DPP compound, which could be related to the unfavorable orientation of the transition dipoles of ICZ and DPP chromophores. Furthermore, in a solid film of the ICZ–π–BODIPY triad an aggregate of the triad molecules was observed, resulting in a redshift of the absorption maximum (~100 nm) relative to a solution.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:55 am CET

High Final Energy of Low-Level Gallium Arsenide Laser Therapy Enhances Skeletal Muscle Recovery without a Positive Effect on Collagen Remodeling

Abstract

The aim of this study was to evaluate the effects of a Gallium Arsenide (GaAs) laser, using a high final energy of 4.8 J, during muscle regeneration after cryoinjury. Thirty Wistar rats were divided into three groups: Control (C, n = 10); Injured (I, n = 10) and Injured and laser treated (Injured/LLLT, n = 10). The cryoinjury was induced in the central region of the tibialis anterior muscle (TA). The applications of the laser (904 nm, 50 mW average power) were initiated 24 h after injury, at energy density of 69 J cm−1 for 48 s, for 5 days, to two points of the lesion. Twenty-four hours after the final application, the TA muscle was removed and frozen in liquid nitrogen to assess the general muscle morphology and the gene expression of TNF-α, TGF-β, MyoD, and Myogenin. The Injured/LLLT group presented a higher number of regenerating fibers and fewer degenerating fibers (P < 0.05) without changes in the collagen remodeling. In addition, the Injured/LLLT group presented a significant decrease in the expression of TNF-α and myogenin compared to the injured group (P < 0.05). The results suggest that the GaAs laser, using a high final energy after cryoinjury, promotes muscle recovery without changing the collagen remodeling in the muscle extracellular matrix.

Thumbnail image of graphical abstract

This study investigated the effects of low-level laser therapy (LLLT) at a high final energy (4.8 J) during muscle regeneration after cryoinjury. Gallium Arsenide (GaAs, 904 nm) laser applied for 5 days in two points of the lesion resulted in a significant decrease in the TNF-α and myogenin, without change in the TGF-β gene expression. The Injured/LLLT group presented a higher number of regenerating fibers and fewer degenerating fibers without changes in the collagen remodeling. The results suggest that the GaAs laser at a high final energy (4.8 J) promotes muscle recovery without changing the collagen remodeling.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:54 am CET

A Novel Microsensor for Measuring Angular Distribution of Radiative Intensity

Abstract

This article presents the design, construction and characterization of a novel type of light probe for measuring the angular radiance distribution of light fields. The differential acceptance angle (DAA) probe can resolve the directionality of a light field in environments with steep light gradients, such as microbial mats, without the need to remove, reorient, and reinsert the probe, a clear advantage over prior techniques. The probe consists of an inner irradiance sensor inside a concentric, moveable light-absorbing sheath. The radiative intensity in a specific zenith direction can be calculated by comparing the irradiance onto the sensor at different acceptance angles. We used this probe to measure the angular radiance distribution of two sample light fields, and observed good agreement with a conventional radiance probe. The DAA probe will aid researchers in understanding light transfer physics in dense microbial communities and expedite validation of numerical radiative transfer models for these environments.

Thumbnail image of graphical abstract

Measurement of the directional dependence of radiative intensity is essential for understanding light transport in microbial mats, plant leaves, soils and phototrophic biofilms. Previously, measuring the directional intensity in these environments required inserting a field radiance probe with a small acceptance angle into a tissue at multiple angles, which required significant time and labor. This paper presents a novel differential acceptance angle (DAA) light probe, which can measure the directional intensity in light fields from a single location without reorienting the probe. We discuss the construction of the DAA probe and its performance compared to a conventional field radiance probe.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:37 am CET

Endogenous Retinoic Acid Required to Maintain the Epidermis Following Ultraviolet Light Exposure in SKH-1 Hairless Mice

Abstract

Ultraviolet light B (UVB) exposure induces cutaneous squamous cell carcinoma (cSCC), one of the most prevalent human cancers. Reoccurrence of cSCC in high-risk patients is prevented by oral retinoids. But oral retinoid treatment causes significant side effects; and patients develop retinoid resistance. Exactly how retinoids prevent UVB-induced cSCC is currently not well understood. Retinoid resistance blocks mechanistic studies in the leading mouse model of cSCC, the UVB-exposed SKH-1 hairless mouse. To begin to understand the role of retinoids in UVB-induced cSCC we first examined the localization pattern of key retinoid metabolism proteins by immunohistochemistry 48 h after UVB treatment of female SKH-1 mice. We next inhibited retinoic acid (RA) synthesis immediately after UVB exposure. Acute UVB increased RA synthesis, signaling and degradation proteins in the stratum granulosum. Some of these proteins changed their localization; while other proteins just increased in intensity. In contrast, acute UVB reduced the retinoid storage protein lectin:retinol acyltransferase (LRAT) in the epidermis. Inhibiting RA synthesis disrupted the epidermis and impaired differentiation. These data suggest that repair of the epidermis after acute UVB exposure requires endogenous RA synthesis.

Thumbnail image of graphical abstract

Ultraviolet light B (UVB) exposure alters the expression of some retinoid metabolism proteins; but an analysis of the complete system in vivo is lacking. We analyzed the expression of retinoid metabolism proteins by immunohistochemistry 48 h after UVB treatment of SKH-1 mice. Acute UVB localized retinoic acid (RA) synthesis and signaling to the upper stratum granulosum; localized RA degradation to the lower stratum granulosum and stratum spinosum; and reduced retinoid storage. Inhibition of RA synthesis by disulfiram damaged the epidermis (image). These results suggest that endogenously synthesized RA is important in epidermal differentiation and repair following UVB exposure.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:34 am CET

Steady-State Spectroscopy of the 2-(N-methylacetimidoyl)-1-naphthol Molecule

Abstract

The steady-state spectroscopy of 2-(N-methylacetimidoyl)-1-naphthol (MAN) reveals composite absorption and emission spectra from 298 to 193 K in hexane. The ground electronic state (So) absorption can be assigned to the sum of three molecular structures: the OH normal tautomer, and two NH proton transfer tautomers. The NH-structures are the most stable ones in equilibrium with the OH tautomer for the S0 state. On photoexcitation of the OH tautomer the excited state intramolecular proton transfer is undergone, and the corresponding NH emission is monitored at 470 nm. On photoexcitation of the NH tautomers the previous emission is monitored in addition to another emission at 600 nm, which is ascribed to intramolecular hydrogen-bonded (IHB) nonplanar NH structures generated from the IHB planar NH tautomers. A Jabłoński diagram is introduced which gathers all the experimental evidence as well as the theoretical calculations executed at the DFT-B3LYP and TD-DFT levels. The MAN molecule is compared with other analogs such as 1-hydroxy-2-acetonaphthone (HAN), 2-(1΄-hydroxy-2΄-naphthyl)benzimidazole and methyl 1-hydroxy-2-naphthoate to validate the theoretical calculations. Photoexcitation of MAN generates two emission bands at longer wavelengths than that of the emission band of HAN. The MAN molecule exhibits a great photostability in hydrocarbon solution which depends on the photophysics of the NH tautomers (keto forms).

Thumbnail image of graphical abstract

The steady-state spectroscopy of 2-(N-methylacetimidoyl)-1-naphthol reveals composite absorption and emission spectra from 298 to 193 K in hexane. The S0 state absorption can be assigned to the sum of three molecular structures in chemical equilibrium: the OH normal tautomer and two NH proton transfer tautomers. On photoexcitation of the OH tautomer the excited state intramolecular proton transfer is undergone, and the corresponding NH emission is monitored at 470 nm. On photoexcitation of the NH tautomers the previous emission is monitored in addition to another emission at 600 nm, which is ascribed to intramolecular hydrogen-bonded (IHB) nonplanar NH tautomers generated from the IHB planar NH tautomers.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:28 am CET

Nanometal Surface Energy Transfer Optical Ruler for Measuring a Human Telomere Structure

Abstract

Nanometal surface energy transfer (NSET) techniques on gold nanoparticles (AuNPs) have become an essential tool in molecular biophysics to identify structural details at long-range donor-acceptor distances. The NSET mechanism is well described, but it has been suggested that the use of large AuNPs in NSET may manipulate natural biomolecular function. If, in fact, such nonspecific interactions with the AuNP surface can be quantified or contained, then NSET may offer more potential in tracking biomolecular folding than the most comprehensive methods in conformer determination (X-ray crystallography, NMR, EPR). Here, we describe an NSET ruler capable of tracking Hybrid-2 telomere quadruplex folding and we demonstrate that nucleic acid appendage to AuNPs up to 10 nm in diameter does not manipulate biomolecular function. The quadruplex folding of Hybrid-2 sequences was tracked by monitoring the emission of a DY680 dye on selected basepairs in the telomere sequence when appended to the surface of AuNPs (5–10 nm). Emission-derived distances extracted from NSET theory correlate well to reported NMR structures of the hybrid quadruplex. Moreover, NSET theory calculates identical donor-acceptor distal points between DY680 and all sizes of AuNPs, indicating that the AuNP tether is not dominant or disruptive towards nucleic acid folding.

Thumbnail image of graphical abstract

Through the use of optical quenching of a molecular dye (DY680) by a gold nanoparticle appended to DNA, the conformation of the Hybrid-2 conformer in telomeric DNA sequence was measured. The results clearly demonstrate the versatility of nanometal surface energy transfer (NSET) molecular rulers for measuring biopolymer structures, allowing mapping of the structure and no evidence of nonspecific interactions between the gold and DNA sequence which would lead to perturbation of the folding landscape.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:27 am CET

Biomodulation of Inflammatory Cytokines Related to Oral Mucositis by Low-Level Laser Therapy

Abstract

This study evaluated the effects of LLLT on the expression of inflammatory cytokines related to the development of oral mucositis by gingival fibroblasts. Primary gingival fibroblasts were seeded on 24-well plates (105 cells/well) for 24 h. Fresh serum-free culture medium (DMEM) was then added, and cells were placed in contact with LPS (Escherichia coli, 1 μg mL−1), followed by LLLT irradiation (LaserTABLE—InGaAsP diode prototype—780 nm, 25 mW) delivering 0, 0.5, 1.5 or 3 J cm². Cells without contact with LPS were also irradiated with the same energy densities. Gene expression of TNF-α, IL-1β, IL-6 and IL-8 was evaluated by Real-Time PCR, and protein synthesis of these cytokines was determined by enzyme-linked immunosorbent (ELISA) assay. Data were statistically analyzed by the Kruskal–Wallis test, complemented by the Mann–Whitney test (< 0.05). LPS treatment increased the gene expression and protein synthesis of TNF-α, IL-6 and IL-8, while the expression of IL-1β was not affected. For LPS-treated groups, LLLT promoted significant decreases in the expression of TNF-α, IL-6, and IL-8 at 1.5 J cm−2 and 3 J cm−2. These results demonstrate that LLLT promoted a beneficial biomodulatory effect on the expression of inflammatory cytokines related to oral mucositis by human gingival fibroblasts.

Thumbnail image of graphical abstract

This study evaluated the effects of low level laser therapy (LLLT) on the expression of inflammatory cytokines involved in the development and severity of oral mucositis. Human gingival fibroblasts treated with LPS (Escherichia coli, 1 μg mL−1) were subjected to LLLT irradiation (LaserTABLE—InGaAsP diode prototype—780 nm, 25 mW) delivering 0, 0.5, 1.5, or 3 J cm². LLLT promoted significant decreases in the expression of TNF-α, IL-6 and IL-8 at 1.5 J cm−2 and 3 J cm−2. These results demonstrate that LLLT promoted a beneficial biomodulatory effect on the expression of inflammatory cytokines related to oral mucositis by human gingival fibroblasts.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:24 am CET

Continuous process of the vacuum ultraviolet- (VUV-) photochemical oxidation of thiophene in the gas phase

Photochem. Photobiol. Sci., 2015, 14,1013-1024
DOI: 10.1039/C4PP00476K, Paper
Haingo L. Andriampanarivo, Martin Kohler, Juan Lopez Gejo, Thomas Betzwieser, Benny C. Y. Poon, Po Lock Yue, Solofonirina D. Ravelomanantsoa, Andre M. Braun
Based on kinetic data and intermediate products of oxidation, reaction pathways of the oxidative degradation of gaseous thiophene are discussed.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 26 Mar 2015 | 1:00 am CET

Correlation between treatment time, photobleaching, inflammation and pain after photodynamic therapy with methyl aminolevulinate on tape-stripped skin in healthy volunteers

Photochem. Photobiol. Sci., 2015, 14,875-882
DOI: 10.1039/C5PP00069F, Paper
Catharina M. Lerche, Susanne Fabricius, Peter A. Philipsen, Hans Christian Wulf
A shorter incubation time with methyl aminolevulinate in healthy volunteers results in decreased photobleaching and also less inflammation and pain.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 25 Mar 2015 | 1:00 am CET

EPR spin trapping evidence of radical intermediates in the photo-reduction of bicarbonate/CO2 in TiO2 aqueous suspensions

Photochem. Photobiol. Sci., 2015, 14,1039-1046
DOI: 10.1039/C4PP00467A, Paper
Alessandra Molinari, Luca Samiolo, Rossano Amadelli
Storage of CO2 as carbonates is a strategy for its reductive activation. Carbonates are reduced at pH 5.5-7.5 with photoexcited TiO2. EPR is convenient for detecting reaction intermediates.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 25 Mar 2015 | 1:00 am CET

Spatial distribution and temporal evolution of DRONPA-fused SNAP25 clusters in adrenal chromaffin cells

Photochem. Photobiol. Sci., 2015, 14,1005-1012
DOI: 10.1039/C4PP00423J, Paper
Open Access Open Access
Yasuko Antoku, Peter Dedecker, Paulo S. Pinheiro, Tom Vosch, Jakob Balslev Sorensen
Sub-diffraction imaging of DRONPA-fused SNAP-25 in adrenal chromaffin cells allows tracking protein cluster dynamics over relative long time (20 min) and reveal that clusters have rich dynamics going from staying constant to disappearing and reappearing within minutes.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Mar 2015 | 1:00 am CET

The contribution of mycosporine-like amino acids, chromophoric dissolved organic matter and particles to the UV protection of sea-ice organisms in the Baltic Sea

Photochem. Photobiol. Sci., 2015, 14,1025-1038
DOI: 10.1039/C4PP00342J, Paper
Jonna Piiparinen, Sara Enberg, Janne-Markus Rintala, Ruben Sommaruga, Markus Majaneva, Riitta Autio, Anssi V. Vahatalo
Variety of mycosporine-like amino acids, chromophoric dissolved organic matter and deposited atmospheric particles provide UV-protection for sea-ice organisms.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Mar 2015 | 1:00 am CET

Survey of UV Emissions from Sunbeds in the UK

Abstract

Increased use of indoor tanning for cosmetic purposes has led to concerns for its impact on the risk of cutaneous cancers. The effects on UVR on skin depend on radiant dose, i.e. combination of irradiance and exposure duration. While a number of studies surveyed accessible emission from sunbeds, majority did not include the information on doses received during tanning sessions. Spectral irradiance of 195 sunbeds in five areas of the United Kingdom was measured in order to assess the radiant doses for comparison with the SED. Erythema weighted irradiance of more than 85% of all tested solaria exceeded 0.3 W m−2, consistent with the findings of other studies. However, evaluation of radiant doses showed no evidence of increasing exposure per session in the United Kingdom in the last decade despite the increasing sunbed emission levels. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under-18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use, and information should reduce the risk of detrimental impact of sunbed use on public health.

Thumbnail image of graphical abstract

Spectral irradiance of 195 sunbeds in five areas of the United Kingdom was measured in order to assess the radiant doses as increased use of indoor tanning has led to concerns for its impact on the risk of cutaneous cancers. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under-18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use and information should reduce the risk of detrimental impact of sunbed use on public health.

Quelle: Photochemistry and Photobiology | 23 Mar 2015 | 9:53 am CET

Photocatalytic Activity of LaSr2AlO5:Eu Ceramic Powders

Abstract

The photocatalytic activity, of undoped and Europium-doped LaSr2AlO5 powders, has been investigated by degrading methylene blue dye in water solutions. Those powders were fabricated by a combustion method and an annealing treatment in air. All samples showed a tetragonal single phase according to by X-ray diffraction measurements (XRD). Scanning electron microscopy (SEM) revealed irregular semi-oval grains with sizes in the range of 3.5–4.27 μm. Photoluminescence spectrum showed sharp emission peaks at 588 nm and at 617 nm which are associated with 7F1,7F2[RIGHTWARDS ARROW] 5D0 Eu3+ ion forbidden transitions, respectively, under UV light excitation of 322 nm. The methylene blue (MB) degradation under UV light (254 nm) was studied by monitoring changes in the absorbance peak of MB at 665 nm. Finally, LaSr2AlO5:Eu powders were used three times and the efficiency for the degradation of MB decreased from 100 to 61% after the third cycle of use.

Thumbnail image of graphical abstract

Europium-doped LaSr2AlO5 (LSA:Eu) has been investigated as photocatalyst for methylene blue degradation in water solutions under UV light. The photograph shows a sequence of the solutions taken each 10 min in the third cycle of use, and achieving total degradation after 360 min of UV irradiation.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:28 am CET

Fluorescence Properties of Diphenylthiazolo[4,5-b]pyrazines Tuned by Donor-Acceptor Substituent Effects

Abstract

Fluorescence properties of 2,6- and 2,5-diphenylthiazolo[4,5-b]pyrazine (TPy) derivatives having an electron-donating substituent (methoxy and dimethylamino) on the 6- and 5-phenyl groups were studied. It was found that 2,6-diphenyl derivatives fluoresce more efficiently than 2,5-diphenyl derivatives. Furthermore, a 2,6-diphenyl derivative having an additional cyano group on the 2-phenyl ring was an excellent fluorophore showing a wide solvatochromism with great fluorescence yields. Based on the obtained spectroscopic data and mechanistic explanations concerning the substituent effects on the fluorescence properties, useful information on designing new TPy fluorophores is provided.

Thumbnail image of graphical abstract

Fluorescence properties of 2,6- and 2,5-diphenylthiazolo[4,5-b]pyrazines having an electron-donating substituent (methoxy and dimethylamino) on the 6- and 5-phenyl groups were studied. Furthermore, 2,6-diphenyl derivatives having an additional cyano group on the 2-phenyl ring were developed, to give an excellent fluorophore.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:09 am CET

Salvianolic Acid B Protects Normal Human Dermal Fibroblasts Against Ultraviolet B Irradiation-Induced Photoaging Through Mitogen-Activated Protein Kinase and Activator Protein-1 Pathways

Abstract

Exposure to ultraviolet (UV) light causes increased matrix metalloproteinase (MMP) activity and decreased collagen synthesis, leading to skin photoaging. Salvianolic acid B (SAB), a polyphenol, was extracted and purified from salvia miltiorrhiza. We assessed effects of SAB on UVB-induced photoaging and investigated its molecular mechanism of action in UVB-irradiated normal human dermal fibroblasts. Our results show that SAB significantly inhibited the UVB-induced expression of metalloproteinases-1 (MMP-1) and interleukin-6 (IL-6) while promoting the production of type I procollagen and transforming growth factor β1 (TGF-β1). Moreover, treatment with SAB in the range of 1–100 μg/mL significantly inhibited UVB-induced extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 phosphorylation, which resulted in decreasing UVB-induced phosphorylation of c-Fos and c-Jun. These results indicate that SAB downregulates UV-induced MMP-1 expression by inhibiting Mitogen-activated protein kinase (MAPK) signaling pathways and activator protein-1 (AP-1) activation. Our results suggest a potential use for SAB in skin photoprotection.

Thumbnail image of graphical abstract

UV causes increased matrix metalloproteinase (MMP) activity and decreased collagen synthesis, leading to skin photoaging. We found that salvianolic acid B (SAB) significantly inhibited the UVB-induced expression of metalloproteinases-1 (MMP-1) while promoting the production of transforming growth factor β1 (TGF-β1). Moreover, SAB strongly inhibited UVB-induced extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 phosphorylation, which resulted in decreasing UVB-induced phosphorylation of c-Fos and c-Jun. These results indicate that SAB down-regulates UV-induced MMP-1 expression by inhibiting mitogen-activated protein kinase (MAPK) signaling pathways and activator protein-1 (AP-1) activation.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:09 am CET

Luciferin-Regenerating Enzyme Mediates Firefly Luciferase Activation Through Direct Effects of D-Cysteine on Luciferase Structure and Activity

Abstract

Luciferin-regenerating enzyme (LRE) contributes to in vitro recycling of D-luciferin. In this study, reinvestigation of the luciferase-based LRE assay is reported. Here, using quick change site-directed mutagenesis seven T-LRE (Lampyris turkestanicusLRE) mutants were constructed and the most functional mutant of T-LRE (T69R) was selected for this research and the effects of D- and L-cysteine on T69R T-LRE-luciferase-coupled assay are examined. Our results demonstrate that bioluminescent signal of T69R T-LRE-luciferase-coupled assay increases and then reach equilibrium state in the presence of 5 mm D-cysteine. In addition, results reveal that 5 mm D- and L-cysteine in the absence of T69R T-LRE cause a significant increase in bioluminescence intensity of luciferase over a long time as well as decrease in decay rate. Based on activity measurements, far-UV CD analysis, ANS fluorescence and DLS (Dynamic light scattering) results, D-cysteine increases the activity of luciferase due to weak redox potential, antiaggregatory effects, induction of changes in conformational structure and kinetics properties. In conclusion, in spite of previous reports on the effect of LRE on luciferase bioluminescent intensity, the majority of increase in luciferase light output and time-course originate from the direct effects of D-cysteine on structure and activity of firefly luciferase.

Thumbnail image of graphical abstract

The addition of D-cysteine in the absence of T69R T-LRE (closed circle) to luciferase reaction increased the bioluminescent level over time in comparison with a luciferase reaction containing D-cysteine in the presence of T69R T-LRE (closed diamond) and control (solid line). Thus, even in the presence of LRE the majority of this increase occurs from the direct effects of D-cysteine.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:07 am CET

Development of highly thermoresponsive fluorescent sensors consisting of plasmonic silver nanoprisms and poly(N-isopropylacrylamide)-fluorophore composites

Photochem. Photobiol. Sci., 2015, 14,870-874
DOI: 10.1039/C4PP00375F, Communication
Kosuke Sugawa, Ryutaro Ichikawa, Naoto Takeshima, Yoshimasa Tanoue, Joe Otsuki
Nanosized highly thermoresponsive fluorescent sensors consisting of silver nanoprisms, PNIPAm, and fluorophores are developed.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 17 Mar 2015 | 1:00 am CET

Variability of Solar Radiation and CDOM in Surface Coastal Waters of the Northwestern Mediterranean Sea

Abstract

Atmospheric and in-water solar radiation, including UVR-B, UVR-A and PAR, as well as chromophoric dissolved organic matter absorption [aCDOM(λ)] in surface waters were monthly measured from November 2007 to December 2008 at a coastal station in the Northwestern Mediterranean Sea (Bay of Marseilles, France). Our results showed that the UVR-B/UVR–A ratio followed the same trend in the atmosphere and at 2 m depth in the water (P < 0.0001) with an increase (eight-fold higher) during summer. The low diffuse attenuation coefficients for downward irradiance [Kd(λ)] of UVR-B, UVR-A and PAR indicated that the waters were highly transparent throughout the year. The relationships between aCDOM(λ) and Kd(λ) in this oligotrophic system suggested that CDOM contributed to UVR attenuation in the UVA domain, but also played a significant role in PAR attenuation. Mean UV doses received in the mixed layer depth were higher by a factor 1.4–33 relative to doses received at fixed depths (5 and 10 m) in summer (stratified period), while the inverse pattern was found in winter (mixing period). This shows the importance of taking into account the vertical mixing in the evaluation of UVR effects on marine organisms.

Thumbnail image of graphical abstract

The wavelengths 305 and 380 nm have been chosen as biologically effective wavelengths for the induction of DNA damages (CPDs) and photorepairs (PERs) respectively. The ratio of the mean doses received within the mixed layer at 305 and 380 nm [Q in % = H(m,305)]/H(m,380) × 100] along with the mixed layer depth (Zm) are presented. Q ratio can be considered as an indicator of changes in the balance between DNA damages (CPDs) and repairs (PERs). Clearly, Q increased with the stratification of the water column.

Quelle: Photochemistry and Photobiology | 16 Mar 2015 | 6:18 am CET

Actual Isothermal Effects of Water-Filtered Infrared A-Irradiation

Abstract

In this study, the athermal effects of water-filtered infrared A (wIRA)-irradiation (780–1400 nm) on human dermal fibroblasts were investigated. For this purpose, cells were exposed to wIRA-irradiation (178 mW cm−2 for 1 h), while a sophisticated experimental setup prevented warming of the samples exceeding 0.1°C. The investigated parameters were the formation of reactive oxygen species (ROS), mitochondrial membrane potential and superoxide release, protein oxidation, proliferation rate, as well as intracellular Ca2+-release in single cells, most of them quantified via fluorescence microscopy and fluorimetric techniques. The existence of actual athermal wIRA-effects is still intensively discussed, since their detection requires a careful experimental setup and both efficient and powerful temperature regulation of the exposed samples. Here, we can definitively show that some of the supposed athermal wIRA-effects may be rather artifacts, since wIRA did not reveal any impact on the above mentioned parameters—as long as the temperature of the exposed cells was carefully maintained. Though, we were able to identify an athermal DNA-protective wIRA-effect, since the induced DNA damage (quantified via 8-Oxo-G-formation) was significantly decreased after a subsequent UVB-exposure. These results suggest that many of the supposed athermal wIRA-effects can be induced by pure warming of the samples, independent from any wIRA-irradiation.

Thumbnail image of graphical abstract

In this work, we exposed human dermal fibroblasts to water-filtered infrared A (wIRA)-irradiation under isothermal conditions in order to investigate changes in the parameters intracellular free calcium, mitochondrial membrane potential and radical production, DNA and protein oxidation, cell proliferation and protection against UVB.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:30 am CET

Human Hair as a Natural Sun Protection Agent: A Quantitative Study

Abstract

The rising incidence of skin cancers attributable to excessive sun exposure has become a major health concern worldwide. While numerous studies have analyzed the sun protective effect of sunscreens, clothing and antioxidants, none to date have measured the photoprotective effect of hair, despite clinical evidence that individuals with balding or thinning hair are at greater risk of skin lesions that can progress to cancer, hence the recommendation to use hats or umbrellas. We analyzed the level of protection offered by hair according to hair density, thickness and color using the spectral transmittance and corrected for relative erythema effectiveness. Our results show that hair provides a barrier against both UVB and UVA radiation which is significantly increased with respect to the hair density, thickness and the presence of melanins. This is the first study to quantify sun protection factor offered by hair, namely hair ultraviolet protection factor (HUPF). We believe that hair should be recognized as an important natural sun barrier in the prevention of UV-induced skin cancers.

Thumbnail image of graphical abstract

Hair provides a barrier against both UVB and UVA radiation which is significantly increased with respect to the hair density (A), thickness (B) and the presence of melanins (hair color) (C). This is the first study to quantify sun protection factor offered by hair, namely hair ultraviolet protection factor (HUPF). Hair should be recognized as an important natural sun barrier in the prevention of UV-induced skin cancers.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:30 am CET

Electron Spin Exchange in Linked Phenothiazine–Viologen Charge Transfer Complexes Incorporated in “Through-Ring” (Rotaxane) α-Cyclodextrins

Abstract

A series of covalently bound phenothiazine (PHZ) donor and methylviologen (V) acceptor compounds with polymethylene chain spacers (C8, C10, C12) were incorporated in a “through-ring” (rotaxane) fashion to α-cyclodextrin (α-CD) hosts such that the alkyl chains were fully extended, with the donor and acceptor on opposite sides of the α-CD cylinder. Photoexcitation of the PHZ unit induces electron transfer from the PHZ first excited triplet state to the V moiety, forming a biradicaloid charge-separated state. Time-resolved electron paramagnetic resonance (TREPR) spectroscopy at the X-band and Q-band microwave frequencies was used to investigate the spin exchange interaction, J, in these biradicaloids. Simulation of the spectra using a “static” model for spin-correlated radical pairs allows extraction of the J values, which are negative in sign and have absolute values range from 2 to 1000 Gauss. Comparison of the PHZnV (n = 8, 10, 12) spectra to those obtained using phenyl ether spacers indicates that π-bonds may assist the electronic coupling. The results are discussed in terms of through-bond vs through-space electronic coupling mechanisms.

Thumbnail image of graphical abstract

Photoexcitation of covalently bound phenothiazine donors with methylviologen acceptors separated by C8, C10 and C12 alkane chain spacers incorporated in a “through-ring” (rotaxane) fashion to α-cyclodextrin hosts leads to biradicaloid charge-separated states that are studied by time-resolved electron paramagnetic resonance spectroscopy at the X-band and Q-band microwave frequencies. Computer simulation of the spectra using a “static” model for spin-correlated radical pairs allows extraction of the spin exchange interactions, which range from –2 to –1000 Gauss. The results are discussed in terms of through-bond vs through-space electronic coupling mechanisms as a function of donor–acceptor distance.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:17 am CET

Histopathological Analysis of UVB and IR Interaction in Rat Skin

Abstract

To determine the chronic skin effects caused by the interaction of infrared and ultraviolet B radiations, male Rattus norvegicus (Wistar) (2 months old) were exposed for 15 days to infrared radiation (600–1500 nm, with a peak at 1000 nm, n = 12) for 30 min (1080 J cm−2) (IRo); to ultraviolet B radiation (peak emission at 313 nm, n = 9) for 90 min (55.08 J cm−2) (UVB); to infrared radiation followed after 90 min by ultraviolet B (n = 6) (IRUVB) and to ultraviolet B followed after 90 min by infrared radiation (n = 9) (UVBIR). Skin samples were collected and histopathological analysis showed the presence of acanthosis, parakeratotic and orthokeratotic hyperkeratosis, intraepidermal pustules, keratin pearls, detachment of epidermis, collagen necrosis, inflammatory infiltrate, vasodilation, basal cell vacuolization and superficial dermis degeneration both in UVB and UVBIR treatments. IRUVB animals showed the same characteristics as above except for parakeratotic hyperkeratosis, keratin pearls and superficial dermis degeneration. To conclude, infrared radiation exposure after ultraviolet B irradiation increases skin damage without protecting the tissue, while infrared radiation exposure before ultraviolet B irradiation showed a protective effect against ultraviolet skin damage.

Thumbnail image of graphical abstract

Chronic IR exposure before UVB irradiation can reduce some of the histopathological alterations caused by UVB while chronic IR exposure after UVB irradiation can enhance most of the histopathological features caused by UVB skin damage.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:14 am CET

Electronic and Vibrational Dynamics of Hollow Au Nanocages Embedded in Cu2O Shells

Abstract

We have synthesized hollow Au nanocages embedded within thick porous shells of cuprous oxide (Cu2O). The shell causes a significant redshift of the localized surface plasmon resonance of Au into the near-IR. Electron–phonon coupling in the Au nanocage is 3–6 times faster in the core–shell structure due to the higher thermal conductivity of Cu2O compared to water. Coherent phonon oscillations within the Au lattice are characterized by a breathing mode of the entire structure for both bare and core–shell nanocages, an assignment made through the use of structural mechanics simulations. The experimental frequencies are obtained through simulations by selectively applying a force to the shell of the core–shell structure. We interpret this as rapid thermal expansion of the gold leading to a mechanical force that acts on the shell.

Thumbnail image of graphical abstract

Femtosecond optical excitation of the localized surface plasmon resonance of Au–Cu2O core-shell nanocages creates hot electrons which transfer energy to the Au and Cu2O lattices on picosecond timescales, leading to coherent vibrational motion. Structural mechanics simulations reproduce the dominant lattice vibrational frequency by treating the rapid thermal expansion of the Au nanocage as a force that acts on the Cu2O shell.

Quelle: Photochemistry and Photobiology | 10 Mar 2015 | 7:32 am CET

Liposomal hypocrellin B as a potential photosensitizer for age-related macular degeneration: pharmacokinetics, photodynamic efficacy, and skin phototoxicity in vivo

Photochem. Photobiol. Sci., 2015, 14,972-981
DOI: 10.1039/C4PP00412D, Paper
Tinghui Li, Xiaobin Hou, Hong Deng, Jingquan Zhao, Naiyan Huang, Jing Zeng, Hongxia Chen, Ying Gu
A novel formulation of liposomal hypocrellin B was prepared and in vivo biology experiments indicated that it has remarkable potential for photodynamic therapy of age-related macular degeneration.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Mar 2015 | 1:00 am CET

Reaction dynamics of the UV-B photosensor UVR8

Photochem. Photobiol. Sci., 2015, 14,995-1004
DOI: 10.1039/C5PP00012B, Paper
Takaaki Miyamori, Yusuke Nakasone, Kenichi Hitomi, John M. Christie, Elizabeth D. Getzoff, Masahide Terazima
The reaction dynamics of an ultraviolet-B (UV-B) photoreceptor protein, UVR8, were revealed for the first time based on the time-resolved diffusion measurement.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Mar 2015 | 1:00 am CET

Quantitative assessment of photostability and photostabilisation of Fluvoxamine and its design for actinometry

Photochem. Photobiol. Sci., 2015, 14,982-994
DOI: 10.1039/C5PP00022J, Paper
Mounir Maafi, Wassila Maafi
Wavelength-dependent forward Image ID:c5pp00022j-t1.gif and reverse Image ID:c5pp00022j-t2.gif Fluvo quantum yields have been reported.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 9 Mar 2015 | 1:00 am CET

Nocturnal melatonin levels decode daily light environment and reflect seasonal states in night-migratory blackheaded bunting (Emberiza melanocephala)

Photochem. Photobiol. Sci., 2015, 14,963-971
DOI: 10.1039/C5PP00045A, Paper
Shalie Malik, Jyoti Singh, Amit Kumar Trivedi, Sudhi Singh, Sangeeta Rani, Vinod Kumar
We proposed two perhaps overlapping hypotheses.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 3 Mar 2015 | 1:00 am CET

Interfacial Engineering of CdO–CdSe 3D Microarchitectures with in situ Photopolymerized PEDOT for an Enhanced Photovoltaic Performance

Abstract

In the present work, porous 3D CdO-microstructured electrode obtained by pyrolysis of 3D CdCO3 microstructures is self-sensitized with CdSe using an ion exchange reaction. After sensitization, an interfacial treatment of the CdO–CdSe interface is performed by depositing a thin film of PEDOT using a photoinduce polymerization route. The microstructured electrode before and after interfacial treatment is characterized using field-emission scanning microscope, energy dispersive X-ray analyzer, contact angle measurement, UV–Visible absorption spectrophotometer and X-ray photoelectron spectrometer. After constructing a liquid junction solar cell with a Pt counter electrode, the photovoltaic performance and interfacial charge transfer kinetics across the CdO–CdSe interface before and after PEDOT treatment are investigated. The results exhibit an improved interfacial charge-transfer resistance after the PEDOT treatment, which leads to enhance the short-circuit current by 15.81% and the power conversion efficiency by 19.82%.

Thumbnail image of graphical abstract

Interfacial engineering of 3D CdO–CdSe-microstructured film by deposition of PEDOT accelerates the interfacial electron transfer rate, and thereby the interfacial electron collection efficiency is enhanced. Thus, the short-circuit current of the device is enhanced significantly.

Quelle: Photochemistry and Photobiology | 28 Feb 2015 | 8:27 am CET

Enhanced Ga2O3-photocatalyzed and photochemical degradation of the Fipronil insecticide by UVC irradiation in mixed aqueous/organic media under an inert atmosphere

Photochem. Photobiol. Sci., 2015, 14,919-928
DOI: 10.1039/C5PP00011D, Paper
Hisao Hidaka, Tohru Tsukamoto, Yoshihiro Mitsutsuka, Toshiyuki Oyama, Nick Serpone
The water-insoluble insecticide Fipronil can be easily mineralized by gallium oxide catalysis in aqueous organic media (ethanol or methanol etc.) under a nitrogen atmosphere under UVC irradiation (254 nm).
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 Feb 2015 | 1:00 am CET

Identification of DXCF cyanobacteriochrome lineages with predictable photocycles

Photochem. Photobiol. Sci., 2015, 14,929-941
DOI: 10.1039/C4PP00486H, Paper
Nathan C. Rockwell, Shelley S. Martin, J. Clark Lagarias
Two specialized subgroups of cyanobacteriochromes with predictable green/blue and blue/orange photocycles are defined by these studies.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 25 Feb 2015 | 1:00 am CET

Decontamination Efficiency of a DBD Lamp Containing an UV–C Emitting Phosphor

Abstract

Among different physical and chemical agents, the UV radiation appears to be an important route for inactivation of resistant microorganisms. The present study introduces a new mercury-free Dielectric Barrier Discharge (DBD) flat lamp, where the biocide action comes from the UV emission produced by rare-earth phosphor obtained by spray pyrolysis, following plasma excitation. In this study, the emission intensity of the prototype lamp is tuned by controlling gas pressure and electrical power, 500 mbar and 15 W, corresponding to optimal conditions. In order to characterize the prototype lamp, the energetic output, temperature increase following lamp ignition and ozone production of the source were measured. The bactericidal experiments carried out showed excellent results for several gram-positive and gram-negative bacterial strains, thus demonstrating the high decontamination efficiency of the DBD flat lamp. Finally, the study of the external morphology of the microorganisms after the exposure to the UV emission suggested that other mechanisms than the bacterial DNA damage could be involved in the inactivation process.

Thumbnail image of graphical abstract

An innovative mercury-free Dielectric Barrier Discharge (DBD) flat lamp has been developed to obtain large spectrum UV-C radiation. The UV-C radiation is produced by a pyrophosphate phosphor doped with Pr3+ (α-Ca2P2O7: Pr2%Na2%) internal coating excited by the 172 nm emission of a Ne-Xe plasma. This work investigates the influence of the plasma parameters on the newly developed UV source energy efficiency and its bactericidal efficiency.

Quelle: Photochemistry and Photobiology | 23 Feb 2015 | 5:36 am CET

Photophysical properties of electron-deficient free-base corroles bearing meso-fluorophenyl substituents

Photochem. Photobiol. Sci., 2015, 14,953-962
DOI: 10.1039/C5PP00060B, Paper
Lei Zhang, Zi-Yu Liu, Xuan Zhan, Li-Li Wang, Hui Wang, Hai-Yang Liu
The ultrafast photophysical behaviors of a series of meso-flurophenyl substituted electron-deficient free base corroles F0C, F5C, F10C and F15C in toluene have been investigated using femtosecond time resolved absorption spectroscopy and steady spectroscopies.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 20 Feb 2015 | 1:00 am CET

Evaluation of Photoprotective Potential and Percutaneous Penetration by Photoacoustic Spectroscopy of the Schinus terebinthifolius Raddi Extract

Abstract

Schinus terebinthifolius is a plant rich in phenolic compounds, which have antioxidant properties and can provide new opportunities for treatment and prevention of diseases mediated by ultraviolet radiation like photoaging and skin cancer. The aim of this study was to evaluate the photoprotective potential and ex vivo percutaneous penetration of the crude extract of Schinus terebinthifolius leaves. The extract was tested for antioxidant activity using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) method and β-carotene bleaching test. The sun protection factor was also evaluated. The ex vivo skin permeation of the emulsion and gel formulations were assayed. Fractionation of the extract resulted in gallic acid, ethyl gallate and a mixture of flavonoids, suggesting derivatives of quercetin and myricetin. The phenolic content of the extract was 384.64 ± 2.60 mg GAE g−1 extract. The antioxidant activity was superior to butylated hydroxytoluene, in DPPH method, and ascorbic acid and rutin, in β-carotene bleaching assay. The extract showed UV absorption with photoprotector potential in the UVB region. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and topical application of the formulations caused no histological changes in the rats' skin. These results suggest that the crude extract of Schinus terebinthifolius leaves may be a promising natural sunscreen product.

Thumbnail image of graphical abstract

Plant extracts can be incorporated in photoprotective formulations. The crude extract and the fraction containing gallic acid, ethyl gallate and a mixture of flavonoids were obtained from Schinus terebinthifolius leaves. Emulsion and gel formulations containing the crude extract were prepared to evaluate the permeation and the histology of the skin after topical application of the formulations. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and related to the permeation of these formulations. No histopathological changes were detected.

Quelle: Photochemistry and Photobiology | 18 Feb 2015 | 12:57 pm CET

Kinetics of benzophenone ketyl free radicals recombination in a polymer: reactivity in the polymer cage vs. reactivity in the polymer bulk

Photochem. Photobiol. Sci., 2015, 14,891-896
DOI: 10.1039/C5PP00024F, Paper
Peter P. Levin, Alexei F. Efremkin, Igor V. Khudyakov
The decay kinetics of intermediates produced under photolysis of benzophenone (B) dissolved in soft rubber poly(ethylene-co-butylene) films (abbreviated as E) was studied by ns laser flash photolysis in the temperature range of 263-313 K.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 18 Feb 2015 | 1:00 am CET

A triphenylphosphine mediated photo-rearrangement and methanol addition of aryl chalcones to 1-propanones

Photochem. Photobiol. Sci., 2015, 14,948-952
DOI: 10.1039/C5PP00009B, Paper
Qiu Sun, Chang Jiang Yao, Burkhard Konig
An unusual rearrangement-addition reaction of aryl chalcones was observed in the presence of triphenylphosphine and UV A irradiation.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 17 Feb 2015 | 1:00 am CET

Hiporfin-Mediated Photodynamic Therapy in Preclinical Treatment of Osteosarcoma

Abstract

This study was carried out to investigate the anti-tumor effect and mechanism of hiporfin-mediated photodynamic therapy (hiporfin-PDT) in osteosarcoma. We found that hiporfin accumulated mainly in the cytoplasm of osteosarcoma cells in a time and concentration-dependent manner. Hiporfin-PDT inhibited the proliferation, induced apoptosis and produced cell cycle arrest at G2M in osteosarcoma cell lines. Hiporfin-PDT increased the expression of cleaved-caspase-3, cleaved PARP-1, Bax and RIP1 while it decreased the expression of Bcl-2; in addition, low concentration of hiporfin increased LC3 conversion. Furthermore, cell death caused by hiporfin-PDT could be rescued by Nec-1 but not by Z-VAD-FMK. Production of reactive oxygen species was increased after hiporfin-PDT. In vivo studies showed a significant decrease in tumor volume and weight after hiporfin-PDT in all three tumor mouse models investigated (subcutaneous and orthotopic). Histological analysis showed widespread cell apoptosis and necrosis after treatment. Immunohistochemistry also showed upregulation of cleaved-caspase-3 and downregulation of Bcl-2 after hiporfin-PDT. These results indicate that hiporfin-PDT exhibits a killing effect in osteosarcoma both in vitro and in vivo, which is associated with apoptosis and necroptosis, while autophagy plays a protective role. All these findings shed light on a potential future clinical use for hiporfin in the treatment of osteosarcoma.

Thumbnail image of graphical abstract

Hiporfin is one kind of photosensitizer that has been approved by Chinese SFDA. In this study, hiporfin was used to see its photodynamic activity in osteosarcoma. After illumination by 630 nm laser, hiporfin killed osteosarcoma cells by increased ROS level and through apoptosis and necroptosis pathways. In vivo study also showed potent tumor eradication. All these provided evidences for the clinical trial of hiporfin on osteosarcoma.

Quelle: Photochemistry and Photobiology | 16 Feb 2015 | 6:38 am CET

Evaluation of the charge transfer efficiency of organic thin-film photovoltaic devices fabricated using a photoprecursor approach

Photochem. Photobiol. Sci., 2015, 14,883-890
DOI: 10.1039/C4PP00477A, Paper
Sadahiro Masuo, Wataru Sato, Yuji Yamaguchi, Mitsuharu Suzuki, Ken-ichi Nakayama, Hiroko Yamada
Evaluation of the charge transfer efficiency of organic thin-film photovoltaic devices using fluorescence microspectroscopy.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 13 Feb 2015 | 1:00 am CET

Photoinduced intercomponent excited-state decays in a molecular dyad made of a dinuclear rhenium(I) chromophore and a fullerene electron acceptor unit

Photochem. Photobiol. Sci., 2015, 14,909-918
DOI: 10.1039/C4PP00301B, Paper
Francesco Nastasi, Fausto Puntoriero, Mirco Natali, Miriam Mba, Michele Maggini, Patrizia Mussini, Monica Panigati, Sebastiano Campagna
A photoinduced triplet charge-separated state is formed in 1 in ca. 100 ps and recombines by a spin-selective process, forming the fullerene triplet state, within 10 ns.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Feb 2015 | 1:00 am CET

One-Pot Synthesis of Cu2O/ZnO Nanoparticles at Present of Folic Acid to Improve UV-Protective Effect of Cotton Fabrics

Abstract

In this study, the effect of using folic acid on the in situ synthesis process of nanostructures has been investigated. Folic acid, as a biotemplate for synthesis of Cu2O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric and avoid agglomeration of the particles. Scanning electron microscopy images revealed that using folic acid caused the formation of particles with smaller sizes on the cotton fabric and X-ray diffraction confirmed the same crystalline pattern of nanoparticles in comparison with the previous synthesis process. The effect of using this biotemplate on different properties of treated fabrics including UV-protection effect, hydrophilicity, crease recovery angle, softness, thickness and mechanical properties has been evaluated. The folic acid had a great influence on UV-protection effect, in synthesis procedure, decreasing the droplet absorption time, bending length and improving the wrinkle resistance and mechanical properties. Interestingly, the higher tensile strength of the treated cotton fabrics proved the incorporation of nanoparticles into the cotton fibers. An in situ, green and rapid method can be provided by using folic acid for the synthesis of the nanostructures with controlled size.

Thumbnail image of graphical abstract

In this work, zinc chloride and copper sulfate have been used as precursors and Cu2O/ZnO nanoparticles have been synthesized in aqueous/alkali media at the presence of cotton fabrics and folic acid. Folic acid, as a biotemplate for synthesis of Cu2O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric. Cotton fabric was used as a soft template to control the synthesis of desirable nanostructures with specific size and morphology.

Quelle: Photochemistry and Photobiology | 10 Feb 2015 | 12:23 pm CET

Tyrosine fluorescence probing of the surfactant-induced conformational changes of albumin

Photochem. Photobiol. Sci., 2015, 14,897-908
DOI: 10.1039/C4PP00432A, Paper
Nadezda G. Zhdanova, Evgeny A. Shirshin, Eugene G. Maksimov, Ivan M. Panchishin, Alexander M. Saletsky, Victor V. Fadeev
Tyrosine fluorescence in native proteins is known to be effectively quenched, whereas its emission increases upon proteins' unfolding.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Feb 2015 | 1:00 am CET

Photoassisted formation of CuxS-based cathodes for CdS-sensitized solar cells with S2-/Sx2- electrolyte

Photochem. Photobiol. Sci., 2015, 14,942-947
DOI: 10.1039/C4PP00314D, Paper
Andriy Kozytskiy, Oleksandr Stroyuk, Mykola Skoryk, Stepan Kuchmiy
The sulfidation of copper nanoparticles deposited onto ZnO surface by the photocatalytic reduction of Cu(II) results in the formation of ZnO/CuxS films that can be used as efficient counter electrodes in solar cells based on sulfide/polysulfide electrolytes.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Feb 2015 | 1:00 am CET

Formulation of Aluminum Chloride Phthalocyanine in Pluronic™ P-123 and F-127 Block Copolymer Micelles: Photophysical properties and Photodynamic Inactivation of Microorganisms

Abstract

Aluminum Chloride Phthalocyanine (AlPcCl) can be used as a photosensitizer (PS) for Photodynamic Inactivation of Microorganisms (PDI). The AlPcCl showed favorable characteristics for PDI due to high quantum yield of singlet oxygen (ΦΔ) and photostability. Physicochemical properties and photodynamic inactivation of AlPcCl incorporated in polymeric micelles of tri-block copolymer (P-123 and F-127) against microorganisms Staphylococcus aureus, Escherichia coli and Candida albicans were investigated in this work. Previously, it was observed that the AlPcCl undergoes self-aggregation in F-127, while in P-123 the PS is in a monomeric form suitable for PDI. Due to the self-aggregation of AlPcCl in F-127, this formulation did not show any effect on these microorganisms. On the other hand, AlPcCl formulated in P-123 was effective against S. aureus and C. albicans and the death of microorganisms was dependent on the PS concentration and illumination time. Additionally, it was found that the values of PS concentration and illumination time to eradicate 90% of the initial population of microorganisms (IC90 and D90, respectively) were small for the AlPcCl in P-123, showing the effectiveness of this formulation for PDI.

Thumbnail image of graphical abstract

Formulations of aluminum chloride phthalocyanine were prepared in polymeric micelles of pluronic surfactants F-127 and P-123 and tested for inactivation of microorganisms. The process of incorporation of AlPcCl on copolymers was effective and the formulation obtained for the system AlPcCl/P-123 had good results against different kind of microorganisms.

Quelle: Photochemistry and Photobiology | 6 Feb 2015 | 7:07 am CET

Solar Spectral Irradiance and Summary Outputs Using Excel

Abstract

The development of an Excel spreadsheet is described that calculates solar spectral irradiance between 290–3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance and percentage of energy in different wavebands. A deliberate goal of the project was to adopt the principle of Ockham's razor and to develop a model that is as simple as it can be commensurate with delivering results of adequate accuracy. Consequently, just four inputs are required—geographical latitude, month, day of month and time of day—resulting in a spreadsheet that is easily usable by anyone with an interest in sunlight and solar power irrespective of their background. The accuracy of the calculated data is sufficient for many applications where knowledge of the ultraviolet, visible and infrared levels in sunlight is of interest.

Thumbnail image of graphical abstract

An Excel spreadsheet that calculates solar spectral irradiance between 290–3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance and percentage of energy in different wavebands. The spreadsheet is easy to use by anyone with an interest in sunlight and solar power irrespective of their background in that just four inputs are required—geographical latitude, month, day of month and time of day.

Quelle: Photochemistry and Photobiology | 6 Feb 2015 | 7:04 am CET

Comparison of optical properties of chromophoric dissolved organic matter (CDOM) in alpine lakes above or below the tree line: insights into sources of CDOM

Photochem. Photobiol. Sci., 2015, 14,1047-1062
DOI: 10.1039/C4PP00478G, Paper
Yaling Su, Feizhou Chen, Zhengwen Liu
Absorption and fluorescence properties of CDOM in 15 alpine lakes were investigated to determine its source and composition. This work provides useful information regarding CDOM in above/below-tree-line alpine lakes.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 4 Feb 2015 | 1:00 am CET

Light Treatment Improves Sleep Quality and Negative Affectiveness in High Arctic Residents During Winter

Abstract

The seasonal extremes of photoperiod in the high Arctic place particular strain on the human circadian system, which leads to trouble sleeping and increased feelings of negative affect in the winter months. To qualify for our study, potential participants had to have been at Canadian Forces Station (CFS) Alert (82° 30′ 00″ N) for at least 2 weeks. Subjects filled out questionnaires regarding sleep difficulty, psychological well-being and mood and wore Actigraphs to obtain objective sleep data. Saliva was collected at regular intervals on two occasions, 2 weeks apart, to measure melatonin and assess melatonin onset. Individuals with a melatonin rhythm that was in disaccord with their sleep schedule were given individualized daily light treatment interventions based on their pretreatment salivary melatonin profile. The light treatment prescribed to seven of the twelve subjects was effective in improving sleep quality both subjectively, based on questionnaire results, and objectively, based on the actigraphic data. The treatment also caused a significant reduction in negative affect among the participants. Since the treatment is noninvasive and has minimal associated side effects, our results support the use of the light visors at CFS Alert and other northern outposts during the winter for individuals who are experiencing sleep difficulty or low mood.

Thumbnail image of graphical abstract

Subjects residing at Canadian Forces Station (CFS) Alert (82° 30′ 00″ N) filled out questionnaires regarding sleep difficulty, psychological well-being and mood and wore Actigraphs to obtain objective sleep data. Saliva was collected prior to and following treatment to measure melatonin and assess melatonin onset. Individuals were given individualized daily light treatment interventions based on their pretreatment salivary melatonin profile. The light treatments were effective in improving sleep quality and reducing negative affect among the participants.

Quelle: Photochemistry and Photobiology | 2 Feb 2015 | 7:02 am CET

Opening Enediyne Scissors Wider: pH-Dependent DNA Photocleavage by meta-Diyne Lysine Conjugates

Abstract

Photochemical activation of meta-diynes incapable of Bergman and C1–C5 cyclizations still leads to efficient double-strand DNA cleavage. Spatial proximity of the two arylethynyl groups is not required for efficient DNA photocleavage by the enediyne-lysine conjugates. Efficiency of the cleavage is a function of the external pH and DNA damage is strongly enhanced at pH < 7. The pH-dependence of the DNA photocleavage activity stems from the protonation states of lysine amino groups, the internal electron donors responsible for intramolecular PET quenching and deactivation of the photoreactive excited states. DNA-binding analysis suggests intercalative DNA binding for phenyl substituted conjugate and groove binding for TFP-substituted conjugate. Additional insights in the possible mechanism for DNA damage from the ROS (Reactive Oxygen Species) scavenger experiments found that generation of singlet oxygen is partially involved in the DNA damage.

Thumbnail image of graphical abstract

Upon photochemical activation, meta-bis-tetrafluoropyridinylalkyne-lysine conjugates induce pH-dependent DNA ds-photocleavage. Efficiency of DNA damage is strongly enhanced at pH < 7. The observed pH-dependence of the DNA photocleavage activity stems from change in the protonation states of lysine amino groups. The ROS (Reactive Oxygen Species) scavenger experiments suggest that singlet oxygen is partially involved in the DNA damage.

Quelle: Photochemistry and Photobiology | 29 Jan 2015 | 6:52 am CET

Interaction of Crown Ether-Annelated Styryl Dyes with Double-Stranded DNA

Abstract

DNA-binding properties of 15-crown-5-derived mono- and bis-styryl dyes were investigated in the presence of calf thymus DNA. To access the factors that influence the DNA association in the series of these ligands, the structure of the molecules was varied by either changing size of the heterocyclic moiety or altering the position of the styryl substituents. The major binding mode for the monostyryl dyes is intercalation. Notably, binding of the dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54. Therefore, these cationic styryl derivatives may be applied as fluorescent “light-up” probes for DNA detection.

Thumbnail image of graphical abstract

Binding of 15-crown-5-derived mono- and bis-styryl dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54.

Quelle: Photochemistry and Photobiology | 23 Jan 2015 | 9:51 am CET

Absorption and Emission Sensitivity of 2-(2′-Hydroxyphenyl)benzoxazole to Solvents and Impurities

Abstract

2-(2′-Hydroxyphenyl)benzoxazole (HBO) is known for undergoing intramolecular proton transfer in the excited state to result in the emission of its tautomer. A minor long-wavelength absorption band in the range 370–420 nm has been reported in highly polar solvents such as dimethylsulfoxide (DMSO). However, the nature of this species has not been entirely clarified. In this work, we provide evidence that this long-wavelength absorption band might have been caused by base or metal salt impurities that are introduced into the spectral sample during solvent transport using glass Pasteur pipettes. The contamination by base or metal salt could be avoided by using borosilicate glass syringes or nonglass pipettes in sample handling. Quantum chemical calculations conclude that solvent-mediated deprotonation is too energetically costly to occur without the aid of a base of an adequate strength. In the presence of such a base, the deprotonation of HBO and its effect on emission are investigated in dichloromethane and DMSO, the latter of which facilitates deprotonation much more readily than the former. Finally, the absorption and emission spectra of HBO in 13 solvents are reported, from which it is concluded that ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

Thumbnail image of graphical abstract

Minor long-wavelength absorption bands of the excited state intramolecular proton transfer (ESIPT) dye 2-(2′-hydroxyphenyl)benzoxazole (HBO) have been observed in DMSO by us and others. These bands might have been caused by base or metal salt impurities introduced by glass Pasteur pipettes that are equipped with latex rubber bulbs. Without the interference of extraneous bases or metal salts, solvent-mediated deprotonation fails to occur. The propensity of HBO to deprotonation is much higher in DMSO than in less polar solvents. The solvatochromic shifts of HBO suggest that the ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

Quelle: Photochemistry and Photobiology | 24 Dec 2014 | 5:56 am CET

Steric and Electronic Factors Associated with the Photoinduced Ligand Exchange of Bidentate Ligands Coordinated to Ru(II)

Abstract

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT), the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complexes 1 and 2 were compared to [Ru(bpy)2(dpb)](PF6)2 (3, bpy = 2,2′-bipyridine) and [Ru(biq)2(phen)](PF6)2 (4, phen = 1,10-phenanthroline). Distortions around the metal and biq ligands were used to explain the exchange of one biq ligand in 4 upon irradiation. Complex 1, however, undergoes photoinduced dissociation of the dpb ligand rather than biq under analogous experimental conditions. Complex 3 is not photoactive, providing evidence that the biq ligands are crucial for ligand photodissociation in 1. The crystal structures of 1 and 4 are compared to explain the difference in photochemistry between the complexes. Complex 2 absorbs lower energy light than 1, but is photochemically inert although its crystal structure displays significant distortions. These results indicate that both the excited state electronic structure and steric bulk play key roles in bidentate photoinduced ligand dissociation. The present work also shows that it is possible to stabilize sterically hindered Ru(II) complexes by the addition of another metal, a property that may be useful for other applications.

Thumbnail image of graphical abstract

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT) with easily tunable excited state properties, the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complex 1 undergoes photoinduced ligand dissociation of the dpb ligand in coordinating solvent in the PCT window, however, the bimetallic complex is photoinert but does absorb lower energy light. The differences in the photophysical properties and the crystal structures of the complexes are discussed and used to explain the differences in photoreactivity.

Quelle: Photochemistry and Photobiology | 23 Dec 2014 | 8:19 am CET

Transition from Charge-Transfer to Largely Locally Excited Exciplexes, from Structureless to Vibrationally Structured Emissions

Abstract

Exciplexes of 9,10-dicyanoanthracene (DCA) with alkylbenzene donors in cyclohexane show structureless emission spectra, typical of exciplexes with predominantly charge-transfer (CT) character, when the donor has a relatively low oxidation potential (Eox), e.g. hexamethylbenzene (HMB). With increasing Eox and stronger mixing with a locally excited (LE) state, vibrational structure begins to appear with 1,2,3,5-tetramethylbenzene and becomes prominent with p-xylene (p-Xy). A simple theoretical model reproduces the spectra and the radiative rate constants, and it reveals several surprises: Even in this nonpolar solvent, the fractional CT character of a highly mixed exciplex varies widely in response to fluctuations in the microscopic environment. Environments that favor the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. It is known that sparsely substituted benzene radical cations, e.g., p-Xy•+, are stabilized more in acetonitrile than the heavily substituted HMB•+. Remarkably, ion pairing with DCA•– in cyclohexane leads to even larger differences in the stabilization of these radical cations. The spectra of the low-Eox donors are almost identical except for displacements that approximately equal the differences in Eox, even though the exciplexes have varying degrees of CT character. These similarities result from compensation among several nonobvious, but quantified factors.

Thumbnail image of graphical abstract

Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (Eox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher Eox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-Eox spectra is illusory, resulting instead from several compensating factors.

Quelle: Photochemistry and Photobiology | 8 Dec 2014 | 7:01 am CET

Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study

Abstract

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.

Thumbnail image of graphical abstract

G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K+ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Following Oxygen Consumption in Singlet Oxygen Reactions via Changes in Sensitizer Phosphorescence

Abstract

This work reports an examination of singlet oxygen reactions with amino acid substrates by a method involving measurement of the change in phosphorescence intensity of the singlet oxygen sensitizer. The sensitizer, a Ru(II) bipyridyl complex covalently linked to pyrene, has long-lived phosphorescence in N2 purged aqueous solutions (τ0 ~ 20 μs) that is nearly completely quenched by oxygen in aerated solutions. Irradiation of the complex in water containing sub mM concentrations of histidine, tryptophan and methionine results in a dramatic, easily visible increase in the phosphorescence intensity over a period of 10–100 s. Rate constants for singlet oxygen oxidation of each of the substrates can be obtained by using changes in the phosphorescence intensity in initial rate kinetic analysis. Rate constants obtained in this way compare favorably with those reported in the literature. The method represents a very simple approach for obtaining rate constants for singlet oxygen reactions with various substrates and the kinetics can be extended to nonaqueous solvents.

Thumbnail image of graphical abstract

Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

o-Amino Analogs of Green Fluorescence Protein Chromophore: Photoisomerization, Photodimerization and Aggregation-induced Emission

Abstract

The photochemical properties of three o-amino analogs of the green fluorescence protein chromophore O0, O1 and O8 (o-ABDIs) have been investigated and compared with those of the m- and p-amino isomers (m-ABDIs and p-ABDIs) in solutions, aggregates, and the solid state. In aprotic solvents, the fluorescence competes with the Z [RIGHTWARDS ARROW] E photoisomerization for all cases, and the o-ABDIs display a fluorescence quantum efficiency of 1–6%, lying between the m-ABDIs of 5–48% and the p-ABDIs of < 0.1%. The fluorescence of both the o- and m-ABDIs is nearly quenched in protic solvents, attributable to the solvent–solute hydrogen bonding (SSHB) interactions. The phenomenon of aggregation-induced emission observed for O8 in poor solvents resembles the behavior of M8 as a consequence of exclusion of the SSHB interactions and restriction of internal rotation for molecules located inside the aggregates. The occurrence of [2 + 2] photodimerization for O0 in the solid state is unique among the ABDIs, and the X-ray crystal structures of O0 and the photodimer OD reveal the head-to-tail syn-oriented stereochemistry. Analysis on the X-ray crystal structures of O0, O1, M0, M1 and P0 shows that not only the pairwise topochemical geometry but also the columnar packing mode is important in determining the photodimerization reactivity.

Thumbnail image of graphical abstract

The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:10 am CET

Photoisomerization of cis-1,2-di(1-Methyl-2-naphthyl)ethene at 77 K in Glassy Media

Abstract

cis-1,2-Di(1-methyl-2-naphthyl)ethene, c-1,1, undergoes photoisomerization in methylcyclohexane, isopentane and diethyl ether/isopentane/ethanol glasses at 77 K. On 313 nm excitation the fluorescence of c-1,1 is replaced by fluorescence from t-1,1. Singular value decomposition reveals that the spectral matrices behave as two component systems suggesting conversion of a stable c-1,1 conformer to a stable t-1,1 conformer. However, the fluorescence spectra are λexc dependent. Analysis of global spectral matrices shows that c-1,1 is a mixture of two conformers, each of which gives one of four known t-1,1 conformers. The λexc dependence of the c-1,1 fluorescence spectrum is barely discernible. Structure assignments to the resolved fluorescence spectra are based on the principle of least motion and on calculated geometries, energy differences and spectra of the conformers. The relative shift of the c-1,1 conformer spectra is consistent with the shift of the calculated absorption spectra. The calculated structure of the most stable conformer of c-1,1 agrees well with the X-ray crystal structure. Due to large deviations of the naphthyl groups from the ethenic plane in the conformers of both c- and t-1,1 isomers, minimal motion of these bulky substituents accomplishes cis [RIGHTWARDS ARROW] trans interconversion by rotation about the central bond.

Thumbnail image of graphical abstract

One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

Quelle: Photochemistry and Photobiology | 21 Nov 2014 | 6:53 am CET

Comparison of Templating Abilities of Urea and Thioruea During Photodimerization of Bipyridylethyelene and Stilbazole Crystals

Abstract

Photodimerization of cocrystals of four bispyridylethylenes and two stilbazoles with urea as a template in the solid state has been investigated following our success with thiourea. Four investigated olefins photodimerized quantitatively to a single dimer in the crystalline state only. The reactivity of urea–olefin crystals is understood on the basis of their packing arrangements in the crystalline state. In reactive crystals the adjacent reactive molecules are within 4.2 Å and parallel, whereas the unreactive ones have their adjacent molecules are farther than 4.6Å and nonparallel. Thus, with the knowledge of crystal packing the reactivity of urea–olefin crystals is predictable on the basis of Schmidt's topochemical postulates. The templating property of urea, similar to thiourea, derives from its ability to form hydrogen bonds with itself and the guest olefins. Despite the similarities in molecular structures of urea and thiourea their subtle electronic properties, yet to be fully understood, affect the crystal packing and consequently their reactivity in the crystalline state. Further work is needed to fully exploit the templating properties of urea.

Thumbnail image of graphical abstract

Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 2:22 pm CET

Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins

Abstract

The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's ketone linkers have been investigated by means of steady state and time-resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well-stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases.

Thumbnail image of graphical abstract

The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

Quelle: Photochemistry and Photobiology | 31 Oct 2014 | 5:46 am CET

Photo-Wolff Rearrangement of 2-Diazo-1,2-naphthoquinone: Stern–Volmer Analysis of the Stepwise Reaction Pathway

Abstract

2-Diazo-1,2-naphthoquinone (1) and its derivatives are the photoactive components in Novolak photoresists. A femtosecond infrared study has established that the photoreaction of 1 proceeds largely by a concerted Wolff rearrangement yielding the ketene 1H-inden-1-ylidene-methanone (3) within 300 fs after excitation, but earlier trapping studies gave evidence for a minor reaction path via a carbene intermediate 1-oxo-2(1H)-naphthalenylidene (2) with a lifetime of about 10 ps. Here, we provide a quantitative assessment of the stepwise pathway by Stern–Volmer analysis of the trapping of 2 by methanol to yield 2-methoxy-1-naphthol (4). We conclude that the lifetime of the carbene 2 is at least 200 ps. Moreover, [3 + 2]cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was observed. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Thumbnail image of graphical abstract

A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Quelle: Photochemistry and Photobiology | 30 Sep 2014 | 12:24 pm CEST

A New Series of Fluorescent Indicators for Super Acids

Abstract

The photophysical properties of fluorescent Hammett acidity indicator derived from 3,4,5,6-tetrahydrobis(pyrido[3,2-g]indolo)[2,3-a:3′,2′-j]acridine (1a), 6-bis(pyrido[3,2-g]indol-2′-yl)pyridine (1b) and their analogues have been investigated in sulfuric acid solutions by means of absorption, fluorimetry, relaxation dynamics and computational approach. These new indicators undergo a reversible protonation process in the Hammett acidity range of H0 < 0, accompanied by a drastic increase of the bright blue-green (1a) or yellow (1b) fluorescence intensity upon increasing the acidity. For 1a in H2SO4, the emission yield increases as large as 200 folds from pH = −0.41 to the Hammett acidity range of −5.17, the results of which are rationalized by a much increase of the steric hindrance upon third protonation toward the central pyridinic site, together with their accompanied changes of electronic configuration from charge transfer to a delocalized ππ* character in the lowest lying excited state. The combination of 1a and 1b renders a wide and linear range of H0 measurement from −1.2 to −5.1 detected by highly intensive fluorescence.

Thumbnail image of graphical abstract

A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pKa as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

Quelle: Photochemistry and Photobiology | 6 Sep 2014 | 2:11 pm CEST




 


Sonstige Hinweise:


Ueber diese Seite:

 

Urheber und Verantwortlich fuer die Inhalte der verlinkten Artikel sind die in den Quellen genannten Anbieter.

 

Hinweise zur Veroeffentlichung Ihrer Pressemitteilung im Bereich Chemie und angrenzende Fachgebiete

Update:

08.10.2009

Thema:

Chronologische Liste mit Fachartikeln zum Thema Photochemie.

Benutzerdefinierte Suche

Internetchemie Copyright: 2007 - 2009 A. J.