[ Sitemap ] [ Kontakt ] [ Impressum ] [ ] Volltext Suche Chemie


Home


Weiteres zum Thema:

Photochemie

Buecher zum Thema


Themenbezogene Artikel

- Biolumineszenz

- Chemie, allgemein

- Fluoreszenz

- Fotosynthese

Weitere Themenbereiche

English Version


Verwandte Themen:

Physikalische Chemie


Aktuelles

Chemie Nachrichten

Stellenmarkt Chemie

Chemie Konferenzen


Chemie A bis Z

Index Chemie

Chemikalien

Internetchemie Lexikon

Produkte und Firmen


About Internetchemie

Internetchemie

Impressum

Service




Photochemie - Neueste Forschungsartikel der Fachverlage


 
Aktuelle Fachartikel zur Photochemie und Photobiologie, sortiert nach Erscheinungsdatum.

Die Urheberrechte und Veroeffentlichungsrechte der in der nachfolgenden Liste aufgefuehrten Fachartikel liegen bei den jeweiligen Verlagen, die am Ende des jeweiligen Artikels als Quelle genannt werden. Diese sind auch fuer die Inhalte verantwortlich.

Hinweise zur Veroeffentlichung Ihrer Pressmitteilung unter Internetchemie.Info entnehmen Sie bitte der entsprechenden Info-Seite.

Diese Seite koennen Sie mit folgender Tastenkombination nach Stichwoertern durchsuchen: <STRG> und <F>.


Auf dieser Seite beruecksichtige naturwissenschaftliche Journale:


Photochemical & Photobiological Sciences - published by The Royal Society of Chemistry -
PPS meets the growing information needs of scientists working in the areas of photochemistry and photobiology, and indeed, encourages a synergism between these two important research areas. This international journal is published monthly on behalf of the European Photochemistry Association (EPA), the European Society for Photobiology (ESP), the Asia and Oceania Society for Photobiology (AOSP) and the Korean Society of Photoscience (KSP), and is available in both print and electronic formats.

Photochemistry and Photobiology - published by Wiley-Interscience -
... publishes original research articles and reviews on current topics in photoscience.



Aktuelle wissenschaftliche Fachartikel der genannten Journale:


Opening Enediyne Scissors Wider: pH-Dependent DNA Photocleavage by meta-Diyne Lysine Conjugates

Abstract

Photochemical activation of meta-diynes incapable of Bergman and C1–C5 cyclizations still leads to efficient double-strand DNA cleavage. Spatial proximity of the two arylethynyl groups is not required for efficient DNA photocleavage by the enediyne-lysine conjugates. Efficiency of the cleavage is a function of the external pH and DNA damage is strongly enhanced at pH < 7. The pH-dependence of the DNA photocleavage activity stems from the protonation states of lysine amino groups, the internal electron donors responsible for intramolecular PET quenching and deactivation of the photoreactive excited states. DNA-binding analysis suggests intercalative DNA binding for phenyl substituted conjugate and groove binding for TFP-substituted conjugate. Additional insights in the possible mechanism for DNA damage from the ROS (Reactive Oxygen Species) scavenger experiments found that generation of singlet oxygen is partially involved in the DNA damage.

Thumbnail image of graphical abstract

Upon photochemical activation, meta-bis-tetrafluoropyridinylalkyne-lysine conjugates induce pH-dependent DNA ds-photocleavage. Efficiency of DNA damage is strongly enhanced at pH < 7. The observed pH-dependence of the DNA photocleavage activity stems from change in the protonation states of lysine amino groups. The ROS (Reactive Oxygen Species) scavenger experiments suggest that singlet oxygen is partially involved in the DNA damage.

Quelle: Photochemistry and Photobiology | 29 Jan 2015 | 6:52 am CET

Salvianolic acid B protects normal human dermal fibroblasts against ultraviolet B irradiation-induced photoaging through Mitogen-activated protein kinase and activator protein-1 pathways

Abstract

Exposure to ultraviolet (UV) light causes increased matrix metalloproteinase (MMP) activity and decreased collagen synthesis, leading to skin photoaging. Salvianolic acid B (SAB), a polyphenol, was extracted and purified from salvia miltiorrhiza. We assessed effects of SAB on UVB-induced photoaging and investigated its molecular mechanism of action in UVB-irradiated normal human dermal fibroblasts. Our results show that SAB significantly inhibited the UVB-induced expression of metalloproteinases-1 (MMP-1) and interleukin-6 (IL-6) while promoting the production of type I procollagen and transforming growth factor β1 (TGF-β1). Moreover, treatment with SAB in the range of 1–100 μg/mL significantly inhibited UVB-induced extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK), and p38 phosphorylation, which resulted in decreasing UVB-induced phosphorylation of c-Fos and c-Jun. These results indicate that SAB down-regulates UV-induced MMP-1 expression by inhibiting Mitogen-activated protein kinase (MAPK) signaling pathways and activator protein-1 (AP-1) activation. Our results suggest a potential use for SAB in skin photoprotection.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 28 Jan 2015 | 6:23 am CET

Survey of UV Emissions from Sunbeds in the UK

Abstract

Increased use of indoor tanning for cosmetic purposes has led to concerns for its impact on the risk of cutaneous cancers. The effects on UVR on skin depend on radiant dose, i.e. combination of irradiance and exposure duration. While a number of studies surveyed accessible emission from sunbeds, majority didn't include the information on doses received during tanning sessions. Spectral irradiance of 195 sunbeds in 5 areas of the UK was measured in order to assess the radiant doses for comparison with the SED. Erythema weighted irradiance of more than 85% of all tested solaria exceeded 0.3 W m−2, consistent with the findings of other studies. However, evaluation of radiant doses showed no evidence of increasing exposure per session in the UK in the last decade despite of the increasing sunbed emission levels. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under-18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use and information should reduce the risk of detrimental impact of sunbed use on public health.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 28 Jan 2015 | 6:04 am CET

Decontamination efficiency of a DBD lamp containing an UV–C emitting phosphor

Abstract

Among different physical and chemical agents, the UV radiation appears to be an important route for inactivation of resistant microorganisms. The present study introduces a new mercury free Dielectric Barrier Discharge (DBD) flat lamp, where the biocide action comes from the UV emission produced by rare earth phosphor obtained by spray pyrolysis, following plasma excitation. In this study, the emission intensity of the prototype lamp is tuned by controlling gas pressure and electrical power, 500 mbar and 15 W, corresponding to optimal conditions. In order to characterize the prototype lamp, the energetic output, temperature increase following lamp ignition and ozone production of the source were measured. The bactericidal experiments carried out showed excellent results for several gram-positive and gram-negative bacterial strains, thus demonstrating the high decontamination efficiency of the DBD flat lamp. Finally, the study of the external morphology of the microorganisms after the exposure to the UV emission suggested that other mechanisms than the bacterial DNA damage could be involved in the inactivation process.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 28 Jan 2015 | 6:01 am CET

Signalling pathway activation by Photodynamic Therapy: NF-[small kappa]B at the crossroad between oncology and immunology.

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00465E, Perspective
Jacques Piette
The response of tumours to photodynamic therapy (PDT) largely varies upon the intensity of the stress created in the cancer cells but also in the local environment. Singlet oxygen has...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 28 Jan 2015 | 1:00 am CET

Low Level Light Therapy Modulates Inflammatory Mediators Secreted by Human Annulus Fibrosus Cells during Intervertebral Disc Degeneration In Vitro

Abstract

Intervertebral disc degeneration (IVD) is one of the important causes of low back pain and is associated with inflammation induced by interaction between macrophages and the human annulus fibrosus (AF) cells. Low-level light therapy (LLLT) has been widely known to regulate inflammatory reaction. However, the effect of LLLT on macrophage-mediated inflammation in the AF cells has not been studied till date. The aim of this study is to mimic the inflammatory microenvironment and to investigate the anti-inflammatory effect of LLLT at a range of wavelengths (405, 532 and 650 nm) on the AF treated with macrophage-like THP-1 cells conditioned medium (MCM) containing proinflammatory cytokines and chemokines (interleukin-1beta, tumor necrosis factor-alpha, interleukin-6 and 8). We observed that AF cells exposed to MCM secrete significantly higher concentrations of IL-6, IL-8, IL-1β and TNF-α. LLLT markedly inhibited secretion of IL-6 at 405 nm in a time-dependent manner. Level of IL-8 was significantly decreased at all wavelengths in a time-dependent manner. We showed that MCM can induce the inflammatory microenvironment in AF cells and LLLT selectively suppressed IL-6 and 8 levels. The results indicate that LLLT is a potential method of IVD treatment and provide insights into further investigation of its anti-inflammation effect on IVD.

Thumbnail image of graphical abstract

The aim of this study is to mimic the inflammatory microenvironment and investigate the anti-inflammatory effect of LLLT at a range of wavelengths (405, 532 and 650 nm) on the AF treated with macrophage-like THP-1 cells conditioned medium (MCM) containing proinflammatory cytokines and chemokines. AF cells exposed to MCM secreted significantly higher concentrations of IL-6, IL-8, IL-1β and TNF-α. LLLT markedly inhibited secretion of IL-6 at 405 nm in a time-dependent manner. Level of IL-8 was significantly decreased at all wavelengths in a time-dependent manner. We showed that MCM can induce the inflammatory microenvironment in AF cells and LLLT selectively suppressed IL-6 and 8 levels.

Quelle: Photochemistry and Photobiology | 27 Jan 2015 | 5:25 am CET

Photoexcited triplet states of UV-B absorbers: ethylhexyl triazone and diethylhexylbutamido triazone

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00373J, Paper
Takumi Tsuchiya, Azusa Kikuchi, Nozomi Oguchi-Fujiyama, Kazuyuki Miyazawa, Mikio Yagi
The excited states of UV-B absorbers, ethylhexyl triazone (EHT) and diethylhexylbutamido triazone (DBT), have been studied through measurements of UV absorption, fluorescence, phosphorescence, triplet-triplet absorption and electron paramagnetic resonance spectra...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 Jan 2015 | 1:00 am CET

Photochemical synthesis of biocompatible and antibacterial silver nanoparticles embedded within polyurethane polymers

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00404C, Communication
Sara Saez, Chiara Fasciani, Kevin Stamplecoskie, Luke B-P Gagnon, Thien-Fah Mah, Maria Luisa Marin, Emilio Alarcon, Tito Scaiano
In-situ light initiated synthesis of silver nanoparticles (AgNP) was employed for AgNP incorporation within the polymeric matrices of medical grade polyurethane. The resulting materials showed improved antibacterial and antibiofilm activity...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 Jan 2015 | 1:00 am CET

Photofunctional proteins: how nature keeps the laboratories updated about light and life

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP90004B, Editorial
Aba Losi, Stefania Abbruzzetti
Welcome to this Photochemical & Photobiological Sciences themed issue entitled "Photofunctional proteins".
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 Jan 2015 | 1:00 am CET

Hiporfin Mediated Photodynamic Therapy in Preclinical Treatment of Osteosarcoma

Abstract

This study was carried out to investigate the anti-tumor effect and mechanism of hiporfin-mediated photodynamic therapy (hiporfin-PDT) in osteosarcoma. We found that hiporfin accumulated mainly in the cytoplasm of osteosarcoma cells in a time and concentration dependent manner. Hiporfin-PDT inhibited the proliferation, induced apoptosis and produced cell cycle arrest at G2M in osteosarcoma cell lines. Hiporfin-PDT increased the expression of cleaved-caspase-3, cleaved PARP-1, Bax and RIP1 while it decreased the expression of Bcl-2; in addition, low concentration of hiporfin increased LC3 conversion. Furthermore, cell death caused by hiporfin-PDT could be rescued by Nec-1 but not by Z-VAD-FMK. Production of reactive oxygen species was increased after hiporfin-PDT. In vivo studies showed a significant decrease in tumor volume and weight after hiporfin-PDT in all three tumor mouse models investigated (subcutaneous and orthotopic). Histological analysis showed widespread cell apoptosis and necrosis after treatment. Immunohistochemisty also showed up-regulation of cleaved-caspase-3 and down-regulation of Bcl-2 after hiporfin-PDT. These results indicate that hiporfin-PDT exhibits a killing effect in osteosarcoma both in vitro and in vivo, which is associated with apoptosis and necroptosis, while autophagy plays a protective role. All these findings shed light on a potential future clinical use for hiporfin in the treatment of osteosarcoma.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 25 Jan 2015 | 12:51 pm CET

Interaction of Crown Ether-Annelated Styryl Dyes with Double-Stranded DNA

Abstract

DNA-binding properties of 15-crown-5-derived mono- and bis-styryl dyes were investigated in the presence of calf thymus DNA. To access the factors that influence the DNA association in the series of these ligands, the structure of the molecules was varied by either changing size of the heterocyclic moiety or altering the position of the styryl substituents. The major binding mode for the monostyryl dyes is intercalation. Notably, binding of the dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54. Therefore, these cationic styryl derivatives may be applied as fluorescent “light-up” probes for DNA detection.

Thumbnail image of graphical abstract

Binding of 15-crown-5-derived mono- and bis-styryl dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54.

Quelle: Photochemistry and Photobiology | 23 Jan 2015 | 9:51 am CET

A safety study of novel photosensitizer Sinoporphyrin Sodium for photodynamic therapy in Beagle dogs

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00463A, Paper
Ni Lin, Chao Li, Zhonghua Wang, Jingxuan Zhang, Xiangfeng Ye, Wenjing Gao, Aiping Wang, Hongtao Jin, Jinfeng Wei
Sinoporphyrin Sodium (DVDMS) is a novel hematoporphyrin-like photosensitizer developed for photodynamic therapy (PDT), an effective therapeutic modality for tumor treatment; while the safety of photosensitizer-based PDT is always of great...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 23 Jan 2015 | 1:00 am CET

NSET optical ruler for measuring a human telomere structure

Abstract

Nanometal surface energy transfer (NSET) techniques on gold nanoparticles (AuNPs) have become an essential tool in molecular biophysics to identify structural details at long-range donor-acceptor distances. The NSET mechanism is well described, but it has been suggested that the use of large AuNPs in NSET may manipulate natural biomolecular function. If, in fact, such non-specific interactions with the AuNP surface can be quantified or contained, then NSET may offer more potential in tracking biomolecular folding than the most comprehensive methods in conformer determination (X-ray crystallography, NMR, EPR). Here we describe an NSET ruler capable of tracking Hybrid-2 telomere quadruplex folding and we demonstrate that nucleic acid appendage to AuNPs up to 10nm in diameter does not manipulate biomolecular function. The quadruplex folding of Hybrid-2 sequences was tracked by monitoring the emission of a DY680 dye on selected basepairs in the telomere sequence when appended to the surface of AuNPs (5-10nm). Emission-derived distances extracted from NSET theory correlate well to reported NMR structures of the antiparallel quadruplex. Moreover, NSET theory calculates identical donor-acceptor distal points between DY680 and all sizes of AuNPs, indicating that the AuNP tether is not dominant or disruptive towards nucleic acid folding.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 22 Jan 2015 | 2:22 pm CET

Solar Spectral Irradiance and Summary Outputs Using Excel

Abstract

The development of an Excel spreadsheet is described that calculates solar spectral irradiance between 290-3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance, and percentage of energy in different wavebands. A deliberate goal of the project was to adopt the principle of Ockham's razor and to develop a model that is as simple as it can be commensurate with delivering results of adequate accuracy. Consequently, just 4 inputs are required - geographical latitude, month, day of month and time of day - resulting in a spreadsheet that is easily usable by anyone with an interest in sunlight and solar power irrespective of their background. The accuracy of the calculated data is sufficient for many applications where knowledge of the ultraviolet, visible and infrared levels in sunlight is of interest.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 21 Jan 2015 | 3:27 pm CET

Cancer targeting with biomolecules: a comparative study of photodynamic therapy efficacy using antibody or lectin conjugated phthalocyanine-PEG gold nanoparticles

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00312H, Paper
Girgis Obaid, Isabelle Chambrier, Michael J. Cook, David A. Russell
The functionalisation of therapeutic nanoparticle constructs with cancer-specific biomolecules can enable selective tumour accumulation and targeted treatment.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 21 Jan 2015 | 1:00 am CET

Formulation of Aluminum Chloride Phthalocyanine in Pluronic™ P-123 and F-127 Block Copolymer Micelles: Photophysical properties and Photodynamic Inactivation of Microorganisms

Abstract

Aluminum Chloride Phthalocyanine (AlPcCl) can be used as a photosensitizer (PS) for Photodynamic Inactivation of Microorganisms (PDI). The AlPcCl showed favorable characteristics for PDI due to high quantum yield of singlet oxygen (ΦΔ) and photostability. Physicochemical properties and photodynamic inactivation of AlPcCl incorporated in polymeric micelles of tri-block copolymer (P-123 and F-127) against microorganisms Staphylococcus aureus, Escherichia coli and Candida albicans were investigated in this work. Previously, it was observed that the AlPcCl undergoes self-aggregation in F-127, while in P-123 the PS is in a monomeric form suitable for PDI. Due to the self-aggregation of AlPcCl in F-127, this formulation did not show any effect on these microorganisms. On the other hand, AlPcCl formulated in P-123 was effective against S. aureus and C. albicans and the death of microorganisms was dependent on the PS concentration and illumination time. Additionally, it was found that the values ​​of PS concentration and illumination time to eradicate 90% of the initial population of microorganisms (IC90 and D90, respectively) were small for the AlPcCl in P-123, showing the effectiveness of this formulation for PDI.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 20 Jan 2015 | 11:14 am CET

Intramolecular Proton Transfer in 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine: Evidence for Tautomer in the Ground State

Abstract

The intramolecular proton transfer in a newly synthesized molecule, 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine (HPOP) is studied using UV-visible absorption, fluorescence emission, fluorescence excitation and time-resolved fluorescence spectroscopy. In the ground state, the molecule exists as cis- and trans-enol in all the solvents. However, in dioxane, alcohols, acetonitrile, dimethylformamide and dimethylsulfoxide the keto tautomer is also observed in the ground state. Dual fluorescence is observed in HPOP where the large Stoke shifted emission is due to emission from the excited-state intramolecular proton transfer product, whereas the other emission is the normal emission from enol form. The fluorescence (both normal and tautomer emission) of HPOP is less than those of corresponding benzoxazole and imidazopyridine derivatives. This reveals that the nonradiative decay becomes more efficient upon substitution of electronegative atom on the charge acceptor group. The pH studies substantiate the conclusion that (unlike in its imidazole analog) the third ground state species is the keto tautomer and not the monoanion. The effect of temperature on cis-enol-trans-enol-keto equilibrium and the nonradiative deactivation from the excited state are also investigated.

Thumbnail image of graphical abstract

Unlike its analogs 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine exists as keto tautomer along as enol in the ground state in several solvents.

Quelle: Photochemistry and Photobiology | 20 Jan 2015 | 6:15 am CET

Influence of Trans Fat on Skin Damage in First-Generation Rats Exposed to UV Radiation

Abstract

The influence of trans fatty acids (TFA) on lipid profile, oxidative damage and mitochondrial function in the skin of rats exposed to ultraviolet radiation (UVR) was assessed. The first-generation offspring of female Wistar rats supplemented from pregnancy with either soybean oil (C-SO, rich in n–6 FA; control group) or hydrogenated vegetable fat (HVF, rich in TFA) were continued with the same supplements until adulthood, when half of each group was exposed to UVR for 12 weeks. The HVF group showed higher TFA cutaneous incorporation, increased protein carbonyl (PC) levels, decreased functionality of mitochondrial enzymes and antioxidant defenses of the skin. After UVR, the HVF group showed increased skin thickness and reactive species (RS) generation, with decreased skin antioxidant defenses. RS generation was positively correlated with skin thickness, wrinkles and PC levels. Once incorporated to skin, TFA make it more susceptible to developing UVR-induced disorders.

Thumbnail image of graphical abstract

Metabolism of trans fat by COX and LOX: The dietary intake of trans fat favors the synthesis of biologically active prostanoids produced during inflammatory processes. After ultraviolet radiation exposure, trans fat supplementation, which is rich in trans fatty acids (TFA), increases the skin thickness, reactive species generation and decreases the skin antioxidant defenses.

Quelle: Photochemistry and Photobiology | 20 Jan 2015 | 6:12 am CET

Photogenerated lophyl radicals in 1-alkyl-3-vinylimidazolium bis(trifluoromethylsulfonyl)imides

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00386A, Paper
Stefan Berdzinski, Bernd Strehmel, Veronika Strehmel
1-Alkyl-3-vinylimidazolium bis(trifluoromethylsulfonyl)imides were investigated as a matrix for photogenerated lophyl radicals obtained by irradiation of o-chlorohexaarylbisimidazole (o-Cl-HABI).
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Jan 2015 | 1:00 am CET

Light-controlled release of nitric oxide from solid polymer composite materials using visible and near infra-red light

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00441H, Paper
Jonathan D. Mase, Anton O. Razgoniaev, Megan K. Tschirhart, Alexis D. Ostrowski
Composite materials were prepared using biocompatible polymers, upconverting nanoparticles, and a nitric oxide (NO) donor complex. We have demonstrated NO release from the solid composites after visible and near infra-red light irradiation.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Jan 2015 | 1:00 am CET

Growth under Visible Light Increases Conidia and Mucilage Production and Tolerance to UV-B Radiation in the Plant Pathogenic Fungus Colletotrichum acutatum

Abstract

Light conditions can influence fungal development. Some spectral wavebands can induce conidial production, whereas others can kill the conidia, reducing the population size and limiting dispersal. The plant pathogenic fungus Colletotrichum acutatum causes anthracnose in several crops. During the asexual stage on the host plant, Colletototrichum produces acervuli with abundant mucilage-embedded conidia. These conidia are responsible for fungal dispersal and host infection. This study examined the effect of visible light during C. acutatum growth on the production of conidia and mucilage and also on the UV tolerance of these conidia. Conidial tolerance to an environmentally realistic UV irradiance was determined both in conidia surrounded by mucilage on sporulating colonies and in conidial suspension. Exposures to visible light during fungal growth increased production of conidia and mucilage as well as conidial tolerance to UV. Colonies exposed to light produced 1.7 times more conidia than colonies grown in continuous darkness. The UV tolerances of conidia produced under light were at least two times higher than conidia produced in the dark. Conidia embedded in the mucilage on sporulating colonies were more tolerant of UV than conidia in suspension that were washed free of mucilage. Conidial tolerance to UV radiation varied among five selected isolates.

Thumbnail image of graphical abstract

Light conditions influence the development of the plant pathogenic fungus Colletotrichum acutatum. Exposures to visible light during fungal growth increased production of conidia and mucilage as well as conidial tolerance to UV. Conidia embedded in the mucilage on sporulating colonies were more tolerant of UV than conidia in suspension that were washed free of mucilage.

Quelle: Photochemistry and Photobiology | 16 Jan 2015 | 5:36 am CET

The effect of a "push-pull" structure on the turn-on fluorescence of photochromic thio-ketone type diarylethenes

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00320A, Paper
Shichong Pang, Daeun Jang, Woo Sun Lee, Hyeok-Mo Kang, Seung-Ju Hong, Sung Kwan Hwang, Kwang-Hyun Ahn
A diarylethene with a six-membered ring carrying an electron-donating sulfur atom and an electron-withdrawing carbonyl group shows fluorescence in its ring-closed state.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 16 Jan 2015 | 1:00 am CET

Introduction

Thumbnail image of graphical abstract

Quelle: Photochemistry and Photobiology | 14 Jan 2015 | 11:46 am CET

Molecular Regulation of UV-Induced DNA Repair

Abstract

Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the United States, as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors.

Thumbnail image of graphical abstract

UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing affected individuals to carcinogenesis as well as to premature aging. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors.

Quelle: Photochemistry and Photobiology | 14 Jan 2015 | 6:55 am CET

Synthesis of Bi2WO6/Bi2O3 Composite with Enhanced Photocatalytic Activity by a Facile One-step Hydrothermal Synthesis Route

Abstract

In this study, the characterization and photocatalytic activity of Bi2WO6/Bi2O3 under visible-light irradiation was investigated in detail. The results suggested that Bi2WO6/Bi2O3 can be synthesized by a facile one-pot hydrothermal route using a super big 200 mL Teflon-lined autoclave with optimal sodium oleate/Bi molar ratio of 1.25. Through the characterization of Bi2WO6/Bi2O3 by X-ray diffraction, scanning electron microscopy, X-ray photoelectron spectroscopy, Fourier transform infrared, UV-vis diffuse reflectance spectra and Photoluminescence spectra, it was found that the as-prepared composite possessed smaller crystallite size and higher visible-light responsive than the pure Bi2WO6. Moreover, it was expected that the as-prepared composites exhibited enhanced photocatalytic activity for the degradation of Rhodamine B under visible-light irradiation, which could be ascribed to their improved light absorption property and the reduced recombination of the photogenerated electrons and holes during the photocatalytic reaction. In general, this study could provide a principle method to synthesize Bi2WO6/Bi2O3 with enhanced photocatalytic activity by one-step hydrothermal synthesis route for environmental purification.

Thumbnail image of graphical abstract

Bi2WO6/Bi2O3 can be synthesized by a facile one-pot hydrothermal route with sodium oleate using a super big 200 mL Teflon-lined autoclave. The as-prepared composites possessed smaller band gap and higher visible-light responsive than the pure Bi2WO6. The as-prepared composites exhibited enhanced photocatalytic activity for the degradation of RhB under visible-light irradiation, which could be ascribed to their improved light absorption property and the reduced recombination of the photogenerated electrons and holes during the photocatalytic reaction.

Quelle: Photochemistry and Photobiology | 14 Jan 2015 | 6:54 am CET

Response of Growth and Photosynthesis of Emiliania huxleyi to Visible and UV Irradiances under Different Light Regimes

Abstract

Microalgae are capable of acclimating to changes in light and ultraviolet radiation (UVR, 280–400 nm). However, little is known about how the ecologically important coccolithophore Emiliania huxleyi responds to UVR when acclimated to different light regimes. Here, we grew E. huxleyi under indoor constant light or fluctuating sunlight with or without UVR, and investigated its growth, photosynthetic performance and pigmentation. Under the indoor constant light regime, the specific growth rate (μ) was highest, while fluctuating outdoor solar radiation significantly decreased the growth rate. Addition of UVR further decreased the growth rate. The repair rate of photosystem II (PSII), as reflected in changes in PSII quantum yield, showed an inverse correlation with growth rate. Cells grown under the indoor constant light regime exhibited the lowest repair rate, while cells from the outdoor fluctuating light regimes significantly increased their repair rate. Addition of UVR increased both the repair rate and intracellular UV-absorbing compounds. This increased repair capability, at the cost of decreased growth rate, persisted after the cells were transferred back to the indoor again, suggesting an enhanced allocation of energy and resources for repair of photosynthetic machinery damage by solar UVR which persisted for a period after transfer from solar UVR.

Thumbnail image of graphical abstract

We grew calcifying Emiliania huxleyi under indoor constant light and fluctuating sunlight regimes with or without UV radiation. The growth rate was the highest under the indoor, significantly decreased under fluctuating outdoor solar radiation, especially in the presence of UV radiation. When the UV-exposed cells were regrown under indoor light, the growth recovered slowly, which were predicted to take a month to catch the previous indoor growth rate. The results indicate that the cells, while growing under fluctuating light, require additional energy and resources for maintaining photosynthetic machinery and synthesizing UV-absorbing compounds at the cost of decreased growth rate.

Quelle: Photochemistry and Photobiology | 14 Jan 2015 | 6:52 am CET

The impact of macrophage-cancer cell interaction on the efficacy of photodynamic therapy

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00451E, Perspective
Mladen Korbelik, Michael R. Hamblin
PDT has different effects on macrophages in tumors. The photosensitizer (PS) is taken up by M2 TAMS inside the tumor, which are killed upon light delivery. Signaling from these dying cells attracts new M1 macrophages from the circulation that can kill remaining tumor cells and stimulate an adaptive immune response.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 14 Jan 2015 | 1:00 am CET

Autophagy, a major adaptation pathway shaping cancer cell death and anticancer immunity responses following photodynamic therapy

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00466C, Perspective
Abhishek D Garg, Hannelore Maes, Erminia Romano, Patrizia Agostinis
Autophagy is a major catabolic pathway in a eukaryotic cell, employed for cellular self-degradation of obsolete or damaged cytoplasmic components serving as a major quality control and recycling mechanism that...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 13 Jan 2015 | 1:00 am CET

One-Pot Synthesis of Cu2O/ZnO Nanoparticles at present of folic acid to improve UV-Protective Effect of Cotton fabrics

Abstract

In this study, the effect of using folic acid on the in situ synthesis process of nanostructures has been investigated. Folic acid, as a bio-template for synthesis of Cu2O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric and avoid agglomeration of the particles. SEM images revealed that using folic acid caused the formation of particles with smaller sizes on the cotton fabric and X-ray diffraction confirmed the same crystalline pattern of nanoparticles in comparison with the previous synthesis process. The effect of using this bio-template on different properties of treated fabrics including UV-protection effect, hydrophilicity, crease recovery angle, softness, thickness and mechanical properties has been evaluated. The folic acid had a great influence on UV-protection effect, in synthesis procedure, decreasing the droplet absorption time, bending length and improving the wrinkle resistance and mechanical properties. Interestingly, the higher tensile strength of the treated cotton fabrics proved the incorporation of nanoparticles into the cotton fibers. An in situ, green and rapid method can be provided by using folic acid for the synthesis of the nanostructures with controlled size.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 12 Jan 2015 | 11:32 am CET

Evaluation of Photoprotective Potential and Percutaneous Penetration by Photoacoustic Spectroscopy of the Schinus terebinthifolius Raddi Extract

Abstract

Schinus terebinthifolius is a plant rich in phenolic compounds, have antioxidant properties and can provide new opportunities for treatment and prevention of diseases mediated by ultraviolet radiation like photoaging and skin cancer. The aim of the present study was to evaluate the photoprotective potential and ex vivo percutaneous penetration of the crude extract of Schinus terebinthifolius leaves. The extract was tested for antioxidant activity using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) method and β-carotene bleaching test. The sun protection factor was also evaluated. The ex vivo skin permeation of the emulsion and gel formulations were assayed. Fractionation of the extract resulted in gallic acid, ethyl gallate and a mixture of flavonoids, suggesting derivatives of quercetin and myricetin. The phenolic content of the extract was 384.64±2.60 mg GAE/g extract. The antioxidant activity was superior to butylated hydroxytoluene, in DPPH method, and ascorbic acid and rutin, in β-carotene bleaching assay. The extract showed UV absorption with photoprotector potential in the UVB region. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and topical application of the formulations caused no histological changes in the rats skin. These results suggest that the crude extract of Schinus terebinthifolius leaves may be a promising natural sunscreen product.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 12 Jan 2015 | 9:43 am CET

Effects of Substituents on Synthetic Analogs of Chlorophylls. Part 4: How Formyl Group Location Dictates the Spectral Properties of Chlorophylls b, d and f

Abstract

Photosynthetic organisms are adapted to light characteristics in their habitat in part via the spectral characteristics of the associated chlorophyll pigments, which differ in the position of a formyl group around the chlorin macrocycle (chlorophylls b, d, f) or no formyl group (chlorophyll a). To probe the origin of this spectral tuning, the photophysical and electronic structural properties of a new set of synthetic chlorins are reported. The zinc and free base chlorins have a formyl group at either the 2- or 3-position. The four compounds have fluorescence yields in the range 0.19–0.28 and singlet excited-state lifetimes of ca 4 ns for zinc chelates and ca 8 ns for the free base forms. The photophysical properties of the 2- and 3-formyl zinc chlorins are similar to those observed previously for 13-formyl or 3,13-diformyl chlorins, but differ markedly from those for 7-formyl analogs. Molecular-orbital characteristics obtained from density functional theory (DFT) calculations were used as input to spectral simulations employing the four-orbital model. The analysis has uncovered the key changes in electronic structure engendered by the presence/location of a formyl group at various macrocycle positions, which is relevant to understanding the distinct spectral properties of the natural chlorophylls a, b, d and f.

Thumbnail image of graphical abstract

The location of the formyl group at the perimeter of the chlorin ring has a profound effect on the position of the long-wavelength chlorin absorption band. Photophysical studies of synthetic formyl chlorins combined with DFT calculations and use of the tetrapyrrole four-orbital model have identified the molecular physical origin of the observed spectral shifts.

Quelle: Photochemistry and Photobiology | 12 Jan 2015 | 7:13 am CET

Nobiletin, a Polymethoxy Flavonoid, Reduced Endothelin-1 Plus SCF-Induced Pigmentation in Human Melanocytes

Abstract

Nobiletin is a unique flavonoid having polymethoxy groups and has exhibited anti-inflammatory and antiobesity effects. Here, we examined the inhibition of nobiletin on melanogenesis induced by endothelin-1 (ET) and stem cell factor (SCF) in normal human melanocytes. Nobiletin dose dependently reduced ET plus SCF-stimulated tyrosinase activity without causing cytotoxicity. Nobiletin reduced cAMP-response element-binding protein (CREB) phosphorylation and microphthalmia-associated transcription factor (MITF) expression, which is a key transcription factor for tyrosinase expression in pigmentation induced by ET plus SCF stimulation. Nobiletin treatment effectively decreased ET plus SCF-induced Raf-1, MEK and ERK1/2 phosphorylation and also downregulated the forskolin-induced phosphorylation of CREB. Furthermore, nobiletin inhibited ET plus SCF-triggered production of melanin and expression of MITF/tyrosinase in a three-dimensional human epidermal model. In accordance with protein expression, the expression of genes related to the pigmentation was also increased in the cells stimulated with ET plus SCF and the cotreatment with nobiletin decreased obviously the ET plus SCF-triggered gene expressions of tyrosinase, PMEL, TRP1 and MITF. Nobiletin contributes to hypopigmentation by downregulating MITF and tyrosinase expression through reduced Raf-1 phosphorylation. Our findings implicate nobiletin as a potential new whitening agent.

Thumbnail image of graphical abstract

Nobiletin inhibited ET plus SCF-triggered production of melanin and expression of MITF/tyrosinase in human melanocytes and a three-dimensional human epidermal model. This is the first research emphasizing the antimelanogenesis potential of nobiletin isolated from citrus and its possibility of beneficial applications in the cosmetic industry.

Quelle: Photochemistry and Photobiology | 12 Jan 2015 | 6:58 am CET

Untangling interactions of a zinc(II) complex containing a coumarin-porphyrin unit with alkaloids in water solutions: a photophysical study

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00359D, Paper
Carla I. M. Santos, Elisabete Oliveira, Hugo M. Santos, Jose C. J. M. D. S. Menezes, M. Amparo F. Faustino, Jose A. S. Cavaleiro, J. L. Capelo, Maria da Graca P. M. S. Neves, Carlos Lodeiro
A metal complex 1 derivative from a coumarin bearing a porphyrin unit is sensitive to the alkaloids caffeine 2, nicotine 3 and cotinine 4 in solution and/or in the gas phase.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Jan 2015 | 1:00 am CET

Gramicidin conformational changes during riboflavin photosensitized oxidation in solution and the effect of N-methylation of tryptophan residues

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00414K, Paper
Denis Fuentealba, Jhon J. Lopez, Marco Palominos, Cristian O. Salas, Marco A. Soto-Arriaza
During riboflavin mediated photo-oxidation, gramicidin changes from intertwined to monomeric conformation (disaggregation), while the methylated derivative is not photo-oxidized.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Jan 2015 | 1:00 am CET

Light Treatment Improves Sleep Quality and Negative Affectiveness in High Arctic Residents During Winter

Abstract

The seasonal extremes of photoperiod in the high Arctic place particular strain on the human circadian system, which leads to trouble sleeping and increased feelings of negative affect in the winter months. To qualify for our study, potential participants had to have been at Canadian Forces Station (CFS) Alert (82° 30’ 00” N) for at least two weeks. Subjects filled out questionnaires regarding sleep difficulty, psychological well-being and mood, and wore Actigraphs to obtain objective sleep data. Saliva was collected at regular intervals on two occasions, two weeks apart, to measure melatonin and assess melatonin onset. Individuals with a melatonin rhythm that was in disaccord with their sleep schedule were given individualized daily light treatment interventions based on their pre-treatment salivary melatonin profile. The light treatment prescribed to seven of the twelve subjects was effective at improving sleep quality both subjectively, based on questionnaire results, and objectively, based on the actigraphic data. The treatment also caused a significant reduction of negative affect among the participants. Since the treatment is non-invasive and has minimal associated side-effects, our results support the use of the light visors at CFS Alert and other northern outposts during the winter for individuals that are experiencing sleep difficulty or low mood.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 9 Jan 2015 | 5:19 pm CET

Effects of Ultraviolet Radiation (UVA+UVB) and Copper on the Morphology, Ultrastructural Organization and Physiological Responses of the Red Alga Pterocladiella capillacea

Abstract

The effect of ultraviolet (UV) radiation and copper (Cu) on apical segments of Pterocladiella capillacea was examined under two different conditions of radiation, PAR (control) and PAR+UVA+UVB (PAR+UVAB), and three copper concentrations, ranging from 0 (control) to 0.62, 1.25 and 2.50 μm. Algae were exposed in vitro to photosynthetically active radiation (PAR) at 70 μmol photons m−2 s−1, PAR + UVB at 0.35 W m−2 and PAR +UVA at 0.70 W m−2 during a 12-h photocycle for 3 h each day for 7 days. The effects of radiation and copper on growth rates, content of photosynthetic pigments and photosynthetic performance were analyzed. In addition, samples were processed for light and transmission electron microscopy. The content of photosynthetic pigments decreased after exposure to radiation and Cu. Compared with PAR radiation and copper treatments modified the kinetics patterns of the photosynthesis/irradiance curve. The treatments also caused changes in the ultrastructure of cortical and subcortical cells, including increased cell wall thickness and accumulation of plastoglobuli, as well as changes in the organization of chloroplasts. The results indicate that the synergistic interaction between UV radiation and Cu in P. capillacea, led to the failure of protective mechanisms and causing more drastic changes and cellular imbalances.

Thumbnail image of graphical abstract

This study shows that both ultraviolet radiation (UVR) and copper (Cu) have deleterious effects on the macroalgae Pterocladiella capillacea, which toxicity led to drastic cellular changes and failure of protective mechanisms. Although UV radiation demonstrated to be more harmful than Cu, our results clearly indicate a synergistic interaction between the two stressors.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 12:42 pm CET

Forty Years of Research on Xeroderma Pigmentosum at the US National Institutes of Health

Abstract

In 1968, Dr. James Cleaver reported defective DNA repair in cultured cells from patients with xeroderma pigmentosum. This link between clinical disease and molecular pathophysiology has sparked interest in understanding not only the clinical characteristics of sun sensitivity, damage and cancer that occurred in XP patients but also the mechanisms underlying the damage and repair. While affected patients are rare, their exaggerated UV damage provides a window into the workings of DNA repair. These studies have clarified the importance of a functioning DNA repair system to the maintenance of skin and neurologic health in the general population. Understanding the role of damage in causing cancer, neurologic degeneration, hearing loss and internal cancers provides an opportunity for prevention and treatment. Characterizing complementation groups pointed to the importance of different underlying genes. Studying differences in cancer age of onset and underlying molecular signatures in cancers occurring either in XP patients or the general population has led to insights into differences in carcinogenic mechanisms. The accelerated development of cancers in XP has been used as a model to discover new cancer chemopreventive agents. An astute insight can be a “tipping point” triggering decades of productive inquiry.

Thumbnail image of graphical abstract

James Cleaver's 1968 report of defective DNA repair in patients with xeroderma pigmentosum (XP) inspired scientists at the National Institutes of Health to initiate long-term studies of patients with XP and related disorders. These have led to a better understanding of the role of DNA repair in protection from sunlight-induced cancer of the skin and eyes, in maintaining the integrity of the nervous system and in human development. XP serves as a model of the effectiveness of sun protection and of oral retinoids in prevention of skin cancers.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 12:42 pm CET

Thioredoxin Reductase Activity may be More Important than GSH Level in Protecting Human Lens Epithelial Cells against UVA Light

Abstract

This study compares the abilities of the glutathione (GSH) and thioredoxin (Trx) antioxidant systems in defending cultured human lens epithelial cells (LECs) against UVA light. Levels of GSH were depleted with either L-buthionine-(S,R)-sulfoximine (BSO) or 1-chloro-2,4-dinitrobenzene (CDNB). CDNB treatment also inhibited the activity of thioredoxin reductase (TrxR). Two levels of O2, 3% and 20%, were employed during a 1 h exposure of the cells to 25 J cm−2 of UVA radiation (338–400 nm wavelength, peak at 365 nm). Inhibition of TrxR activity by CDNB, combined with exposure to UVA light, produced a substantial loss of LECs and cell damage, with the effects being considerably more severe at 20% O2 compared to 3%. In contrast, depletion of GSH by BSO, combined with exposure to UVA light, produced only a slight cell loss, with no apparent morphological effects. Catalase was highly sensitive to UVA-induced inactivation, but was not essential for protection. Although UVA light presented a challenge for the lens epithelium, it was well tolerated under normal conditions. The results demonstrate an important role for TrxR activity in defending the lens epithelium against UVA light, possibly related to the ability of the Trx system to assist DNA synthesis following UVA-induced cell damage.

Thumbnail image of graphical abstract

Exposure of cultured human lens epithelial cells (LECs) to UVA light (25 J cm−2), or pretreatment of the cells with an inhibitor (1-chloro-2,4-dinitrobenzene) of thioredoxin reductase (TrxR), produced no damaging cellular effects. However, a combination of the two challenges produced substantial loss of LECs and cell damage, including death (arrows) and threadlike structures (arrowheads). In contrast, depletion of reduced glutathione (GSH) by L-buthionine-(S,R)-sulfoximine, combined with exposure to UVA light, produced only a slight cell loss, with no apparent morphological effects. The results demonstrate an important role for TrxR activity, possibly more so than GSH level, in defending the lens epithelium against UVA light.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 10:04 am CET

Unveiling the Triplet State of a 4-Amino-7-Nitrobenzofurazan Derivative in Cyclohexane

Abstract

The nitrobenzofurazan (NBD) moiety has gained tremendous popularity over the last decades due to its fluorogenic nature. Indeed, upon interaction with aliphatic amines, it generates a stable fluorescent adduct, which has been used for protein and lipid labeling. In fact the 4-amino substituted NBD belongs to the broad family of intramolecular charge transfer molecules, with the amino group acting as an electron donor upon photoexcitation, and the nitro group as an electron acceptor. Although the singlet excited state of 4-amino NBD derivatives has been abundantly studied, investigation of its triplet manifold is scarce and even the absence of intersystem crossing for this type of molecules has been suggested. However, intramolecular charge transfer molecules are known to undergo intersystem crossing and high phosphorescence quantum yields have been reported in a nonpolar solvent. In the present paper, we have investigated the photophysical and photochemical properties of N-hexyl-7-nitrobenzo[c][1,2,5]xadiazole-4-amine. We have shown the existence of a triplet state for this molecule in cyclohexane via nanosecond laser flash photolysis. Interestingly, deactivation of the triplet state leads to photoproducts formation, which are only present in the absence of oxygen.

Thumbnail image of graphical abstract

While NBD derivatives are very popular fluorogenic compounds and their first excited states are well characterized, no study had investigated the ability of these compounds to undergo intersystem crossing. As many other intramolecular charge transfer molecules, NBD derivatives present a triplet state in a nonpolar solvent such as cyclohexane.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 10:02 am CET

Excited-State Multiple Proton Transfer Depending on the Acidity and Basicity of Mediating Alcohols in 7–Azaindole–(ROH)2 (R = H, CH3) Complexes: A Theoretical Study

Abstract

Long-range proton transfer plays an important role in many chemical and biological phenomena. It has recently been reported that the rate of excited–state multiple proton transfer depends on the acidity and basicity of mediating alcohols in the H–bonded wire. The excited–state triple proton transfer in 7–azaindole complexes through cyclic H–bonded wires was theoretically studied to investigate rates depending on the mediating alcohols. This study showed that the acidity and basicity of alcohols collectively functioned to assist proton transfers depending on the paths; the proton transfers of protolytic and solvolytic paths were assisted by the pull–behind effect and the push–ahead effect, respectively. Both proton–donating and accepting abilities of alcohols in the H–bonded wire can accumulate to help proton transfer, and the strong acidity and basicity of the alcohols with relatively small structural changes in the wire have larger impacts on reducing the activation energies than those of alcohols that trigger proton transfer.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 7 Jan 2015 | 6:51 am CET

Hyperactive Arg39Lys mutated mnemiopsin: implication of positively charged residue in chromophore binding cavity

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00191E, Paper
Atiyeh Mahdavi, Reza H Sajedi, Saman Hosseinkhani, Majid Taghdir
Mnemiopsin, a Ca2+-regulated photoprotein, belongs to family of ctenophore photoproteins. These proteins emit blue light from a chromophore which is tightly but noncovalently bound in their central hydrophobic core that...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 Jan 2015 | 1:00 am CET

Excitonic Dynamics of Chlorophyll-a Molecules in Chitosan Hydrogel Scaffold

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00305E, Paper
Pubali Mandal, jhimli Sarkar Manna, Debmallya Das, Manoj Kumar Mitra
Excitonic Dynamics of Chlorophyll-a Molecules in Chitosan Hydrogel Scaffold Pubali Mandal a, Jhimli Sarkar Manna[double dagger] a, Debmallya Dasb, Manoj Kumar Mitrab Biomimetic photo harvesting architecture are being realized as an...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 Jan 2015 | 1:00 am CET

Interphotoreceptor Retinoid-Binding Protein Protects Retinoids from Photodegradation

Abstract

Retinol degrades rapidly in light into a variety of photoproducts. It is remarkable that visual cycle retinoids can evade photodegradation as they are exchanged between the photoreceptors, retinal pigment epithelium and Müller glia. Within the interphotoreceptor matrix, all-trans retinol, 11-cis retinol and retinal are bound by interphotoreceptor retinoid-binding protein (IRBP). Apart from its role in retinoid trafficking and targeting, could IRBP have a photoprotective function? HPLC was used to evaluate the ability of IRBP to protect all-trans and 11-cis retinols from photodegradation when exposed to incandescent light (0 to 8,842 μW/cm2); time periods of 0 – 60 min, and bIRBP: retinol molar ratios of 1:1 to 1:5. bIRBP afforded a significant prevention of both all-trans and 11-cis retinol to rapid photodegradation. The effect was significant over the entire light intensity range tested, and extended to the bIRBP: retinol ratio 1:5. In view of the continual exposure of the retina to light, and the high oxidative stress in the outer retina, our results suggest IRBP may have an important protective role in the visual cycle by reducing photodegradation of all-trans and 11-cis retinols. This role of IRBP is particularly relevant in the high flux conditions of the cone visual cycle.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 6 Jan 2015 | 3:46 pm CET

Photochemistry of N-(selenoalkyl)-phthalimides. Formation of N, Se-heterocyclic systems

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00452C, Paper
Gabriela Oksdath-Mansilla, Adrian A. Heredia, Juan E. Arguello, Alicia B. Penenory
A number of selenium heterocyclic derivatives are obtained upon direct or acetone-sensitized irradiation of a variety of N-(selenomethyl)alkyl-phthalimides. The reaction proceeds by photoinduced intramolecular electron transfer between the Se atom and the phthalimide moiety.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 6 Jan 2015 | 1:00 am CET

Measurement of photosynthesis using PAM technology in a purple sulphur bacterium Thermochromatium tepidum (Chromatiaceae)

Abstract

We demonstrate that Blue-diode-based PAM (Pulse Amplitude Modulation) technology can be used to measure the photosynthetic electron transport rate (ETR) of purple sulphur bacteria (Thermochromatium tepidum, Chromatiaceae). Previous studies showed that PAM technology could be used to estimate photosynthesis in purple non-sulphur bacteria and so PAM technology can be used to estimate photosynthesis of both kinds of purple photosynthetic bacteria. The absorptance of Thermochromatium films on glass fibre discs was measured and used to calculate actual ETR. ETR vs. Irradiance (P vs. E) curves fitted the waiting-in-line model (ETR = (ETRmax×E/Eopt) × exp (1-E/Eopt)). Yield (Y) was only ≈ 0.3 to 0.4. Thermochromatium saturates at 325 ± 13.8 μmol photons m−2 s−1 or ≈ 15% sunlight and shows photoinhibition at high irradiances. A pond of Thermochromatium would exhibit classic surface inhibition. Photosynthesis is extremely low in the absence of an electron source: ETR increases in the presence of acetate (5 mol m−3) provided as an organic carbon source and also increases in the presence of sulphite (3 mol m−3) but not sulphide and is only marginally increased by the presence of Fe2+. Non-photochemical quenching does occur in Thermochromatium but at very low levels compared to oxygenic photoorganisms or Rhodopseudomonads.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 2 Jan 2015 | 6:35 am CET

Improved Efficiency and Stability of Flexible Dye Sensitized Solar Cells on ITO/PEN Substrates Using an Ionic Liquid Electrolyte

Abstract

Flexible dye-sensitized solar cells (DSSCs) built on plastic substrates have attracted great interest as they are lightweight and can be roll-to-roll printed to accelerate production and reduce cost. However, plastic substrates such as PEN and PET are permeable to water, oxygen and volatile electrolyte solvents, which is detrimental to the cell stability. Therefore, to address this problem, in this work, an ionic liquid (IL) electrolyte is used to replace the volatile solvent electrolyte. The initial IL-based devices only achieved around 50% of the photovoltaic conversion efficiency of the cells using the solvent electrolyte. Current-voltage and electrochemical impedance spectroscopy (EIS) analysis of the cells in the dark indicated that this lower efficiency mainly originated from (i) a lack of blocking layer to reduce recombination, and (ii) a lower charge collection efficiency. To combat these problems, cells were developed using a 12 nm thick blocking layer, produced by atomic layer deposition, and 1 μm thick P25 TiO2 film sensitized with the hydrophobic MK-2 dye. These flexible DSSCs utilizing an IL electrolyte exhibit significantly improved efficiencies and a <10% drop in performance after 1000 h aging at 60°C under continuous light illumination.

Thumbnail image of graphical abstract

Flexible dye-sensitized solar cells (DSSCs) with enhanced stability, built on ITO/PEN substrates and using an ionic liquid (IL) electrolyte, have been developed. A 12 nm thick blocking layer, produced by atomic layer deposition, was used to reduce electron recombination, and a 1 μm thick TiO2 film sensitized with the hydrophobic MK-2 dye was used to improve charge collection and extraction. These flexible DSSCs exhibit comparable efficiency to those cells using a solvent based electrolyte plus significantly improved stability, with a <10% drop in performance after 1000 h aging at 60°C under continuous light illumination.

Quelle: Photochemistry and Photobiology | 30 Dec 2014 | 6:49 am CET

Application of CdTe/ZnSe Quantum Dots in In Vitro Imaging of Chicken Tissue and Embryo

Abstract

The present work is aimed to synthesize CdTe/ZnSe core/shell quantum dots (QDs) in an easy way and to explore the possibilities of its application in in vitro imaging of chicken tissue and embryo. The QDs were prepared using microwave irradiation with different temperatures, which is a very easy and less time-consuming method. Subsequently, these QDs were characterized by spectrofluorimetry, Transmission Electron Microscopy, X-ray fluorescence analysis and Dynamic Light Scattering measurement. A blueshifting of the emission was found when ZnSe was deposited on CdTe QDs. The QDs showed its fluorescence emission quantum yields up to 25%. They were applied into chicken embryos and breast muscle tissues to study their efficiency in in vitro imaging. All the QDs of different color were able to visualize in in vitro imaging. The highest fluorescence intensity was detected in the case of red QDs prepared at 100°C. The green and red QDs were possible to detect up to the depth of 3 and 4 mm of the tissue, respectively.

Thumbnail image of graphical abstract

CdTe/ZnSe core/shell quantum dots (QDs) were prepared using microwave irradiation with different temperatures which is a very easy and less time-consuming method. The QDs were characterized by spectrofluorimetry, TEM, X-ray fluorescence analysis and Dynamic Light Scattering measurement. A blueshifting of the emission was found when ZnSe was deposited on CdTe QDs. All the QDs were able to visualize in in vitro imaging of chicken tissue and embryo and the QDs prepared at 100°C showed the best result.

Quelle: Photochemistry and Photobiology | 30 Dec 2014 | 6:45 am CET

Low-level Laser (Light) Therapy Increases Mitochondrial Membrane Potential and ATP Synthesis in C2C12 Myotubes with a Peak Response at 3–6 h

Abstract

Low-level laser (light) therapy has been used before exercise to increase muscle performance in both experimental animals and in humans. However, uncertainty exists concerning the optimum time to apply the light before exercise. The mechanism of action is thought to be stimulation of mitochondrial respiration in muscles, and to increase adenosine triphosphate (ATP) needed to perform exercise. The goal of this study was to investigate the time course of the increases in mitochondrial membrane potential (MMP) and ATP in myotubes formed from C2C12 mouse muscle cells and exposed to light-emitting diode therapy (LEDT). LEDT employed a cluster of LEDs with 20 red (630 ± 10 nm, 25 mW) and 20 near-infrared (850 ± 10 nm, 50 mW) delivering 28 mW cm2 for 90 s (2.5 J cm2) with analysis at 5 min, 3 h, 6 h and 24 h post-LEDT. LEDT-6 h had the highest MMP, followed by LEDT-3 h, LEDT-24 h, LEDT-5 min and Control with significant differences. The same order (6 h > 3 h > 24 h > 5 min > Control) was found for ATP with significant differences. A good correlation was found (r = 0.89) between MMP and ATP. These data suggest an optimum time window of 3–6 h for LEDT stimulate muscle cells.

Thumbnail image of graphical abstract

Mechanism of action of LLLT or LEDT on mitochondria in muscle cells. There is an increased flux of electrons through all the complexes of the electron transport chain, increased pumping of H+, increased synthesis of ATP and increased mitochondrial membrane potential as shown by TMRM fluorescence. The result is that muscles can perform much more work when light is delivered 3–6 h before exercise.

Quelle: Photochemistry and Photobiology | 30 Dec 2014 | 6:32 am CET

Absorption and Emission Sensitivity of 2-(2′-Hydroxyphenyl)benzoxazole to Solvents and Impurities

Abstract

2-(2′-Hydroxyphenyl)benzoxazole (HBO) is known for undergoing intramolecular proton transfer in the excited state to result in the emission of its tautomer. A minor long-wavelength absorption band in the range 370–420 nm has been reported in highly polar solvents such as dimethylsulfoxide (DMSO). However, the nature of this species has not been entirely clarified. In this work, we provide evidence that this long-wavelength absorption band might have been caused by base or metal salt impurities that are introduced into the spectral sample during solvent transport using glass Pasteur pipettes. The contamination by base or metal salt could be avoided by using borosilicate glass syringes or nonglass pipettes in sample handling. Quantum chemical calculations conclude that solvent-mediated deprotonation is too energetically costly to occur without the aid of a base of an adequate strength. In the presence of such a base, the deprotonation of HBO and its effect on emission are investigated in dichloromethane and DMSO, the latter of which facilitates deprotonation much more readily than the former. Finally, the absorption and emission spectra of HBO in 13 solvents are reported, from which it is concluded that ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

Thumbnail image of graphical abstract

Minor long-wavelength absorption bands of the excited state intramolecular proton transfer (ESIPT) dye 2-(2′-hydroxyphenyl)benzoxazole (HBO) have been observed in DMSO by us and others. These bands might have been caused by base or metal salt impurities introduced by glass Pasteur pipettes that are equipped with latex rubber bulbs. Without the interference of extraneous bases or metal salts, solvent-mediated deprotonation fails to occur. The propensity of HBO to deprotonation is much higher in DMSO than in less polar solvents. The solvatochromic shifts of HBO suggest that the ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

Quelle: Photochemistry and Photobiology | 24 Dec 2014 | 5:56 am CET

Steric and Electronic Factors Associated with the Photoinduced Ligand Exchange of Bidentate Ligands Coordinated to Ru(II)

Abstract

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT), the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complexes 1 and 2 were compared to [Ru(bpy)2(dpb)](PF6)2 (3, bpy = 2,2′-bipyridine) and [Ru(biq)2(phen)](PF6)2 (4, phen = 1,10-phenanthroline). Distortions around the metal and biq ligands were used to explain the exchange of one biq ligand in 4 upon irradiation. Complex 1, however, undergoes photoinduced dissociation of the dpb ligand rather than biq under analogous experimental conditions. Complex 3 is not photoactive, providing evidence that the biq ligands are crucial for ligand photodissociation in 1. The crystal structures of 1 and 4 are compared to explain the difference in photochemistry between the complexes. Complex 2 absorbs lower energy light than 1, but is photochemically inert although its crystal structure displays significant distortions. These results indicate that both the excited state electronic structure and steric bulk play key roles in bidentate photoinduced ligand dissociation. The present work also shows that it is possible to stabilize sterically hindered Ru(II) complexes by the addition of another metal, a property that may be useful for other applications.

Thumbnail image of graphical abstract

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT) with easily tunable excited state properties, the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complex 1 undergoes photoinduced ligand dissociation of the dpb ligand in coordinating solvent in the PCT window, however, the bimetallic complex is photoinert but does absorb lower energy light. The differences in the photophysical properties and the crystal structures of the complexes are discussed and used to explain the differences in photoreactivity.

Quelle: Photochemistry and Photobiology | 23 Dec 2014 | 8:19 am CET

The singlet-oxygen-sensitized delayed fluorescence in mammalian cells: a time-resolved microscopy approach

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00339J, Paper
Marek Scholz, Anna-Louisa Biehl, Roman Dedic, Jan Hala
Microsecond kinetics of singlet-oxygen-sensitized delayed fluorescence (SOSDF) have been detected from individual living fibroblast cells as a proof-of-concept. These provide valuable information about excited state lifetimes and their changes during PDT-like treatment.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 23 Dec 2014 | 1:00 am CET

Degradation of two fluoroquinolone antibiotics photoinduced by Fe(III)-microalgae suspension in an aqueous solution

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C3PP50149C, Paper
Liyun Ge, Huanhuan Deng
Two fluoroquinolone (FQ) antibiotics, enrofloxacin (ENR) and ciprofloxacin hydrochloride (CIP), and two marine microalgae, Platymonas subcordiformis and Isochrysis galbana, were investigated under irradiation with a high-pressure mercury lamp (HPML) in a laboratory-scale experiment.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 23 Dec 2014 | 1:00 am CET

Spectroscopic Properties of Morin in Various CH3OH-H2O and CH3CN-H2O Mixed Solvents

Abstract

The specific fluorescence properties of morin (3,2’,4’,5,7-pentahydroxyflavone) were studied in various CH3OH-H2O and CH3CN-H2O mixed solvents. Although the dihedral angle is large in the S0 state, morin has an almost planar molecular structure in the S1 state owing to the very low rotational energy barrier around the interring bond between B and the A, C ring. The excited state intramolecular proton transfer (ESIPT) at the S1 state cannot occur immediately after excitation, S1 [RIGHTWARDS ARROW] S0 fluorescence can be observed. Two conformers, Morin A and B have been known. At the CH3OH-H2O, Morin B will be the principal species but at the CH3CN-H2O, Morin A is the principal species. At the CH3OH-H2O, owing to the large Franck-Condon (FC) factor for S2 [RIGHTWARDS ARROW] S1 internal convernal (IC) and flexible molecular structure, only S1 [RIGHTWARDS ARROW] S0 fluorescence was exhibited. At the CH3CN-H2O, since the FC factor for S2 [RIGHTWARDS ARROW] S1 IC is small and molecular structure is rigid, S2 [RIGHTWARDS ARROW] S0 and S1 [RIGHTWARDS ARROW] S0 dual fluorescence was observed. This abnormal fluorescence property was further orted by the small pK1 value, effective delocalization of the lone pair electrons of C(2’)-OH to the A, C ring, and a theoretical calculation.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 22 Dec 2014 | 3:52 pm CET

Regulation and Disregulation of Mammalian Nucleotide Excision Repair: A Pathway to Nongermline Breast Carcinogenesis

Abstract

Nucleotide excision repair (NER) is an important modulator of disease, especially in constitutive deficiencies such as the cancer predisposition syndrome Xeroderma pigmentosum. We have found profound variation in NER capacity among normal individuals, between cell-types and during carcinogenesis. NER is a repair system for many types of DNA damage, and therefore many types of genotoxic carcinogenic exposures, including ultraviolet light, products of organic combustion, metals and oxidative stress. Because NER is intimately related to cellular metabolism, requiring components of both the DNA replicative and transcription machinery, it has a narrow range of functional viability. Thus, genes in the NER pathway are expressed at the low levels manifested by, for example, nuclear transcription factors. As NER activity and gene expression vary by cell-type, it is inherently epigenetically regulated. Furthermore, this epigenetic modulation is disregulated during sporadic breast carcinogenesis. Loss of NER is one basis of genomic instability, a required element in cellular transformation, and one that potentially influences response to therapy. In this study, we demonstrate differences in NER capacity in eight adult mouse tissues, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

Thumbnail image of graphical abstract

We have shown profound variation in NER (Nucleotide Excision Repair) capacity in humans, between cell-types and during carcinogenesis. As NER is intimately related to both replication and transcription, it shows a narrow range of functional viability. NER activity and gene expression are epigenetically regulated, although this epigenetic modulation is disregulated during sporadic breast carcinogenesis. We now demonstrate differences in NER capacity in eight adult mouse tissues, including a complete lack of activity in brain, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

Quelle: Photochemistry and Photobiology | 19 Dec 2014 | 7:07 am CET

Photocatalytic reduction of CO2 over platinised Bi2WO6-based materials

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00407H, Paper
S. Murcia-Lopez, V. Vaiano, M. C. Hidalgo, J. A. Navio, D. Sannino
Bi2WO6 and Bi2WO6-TiO2 were synthesized, platinised and evaluated in the photocatalytic reduction of CO2. The methane yield was greatly improved by platinisation and TiO2 addition. Blue phosphors enhanced the system stability.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Dec 2014 | 1:00 am CET

Apoptosis and associated phenomena as a determinants of the efficacy of photodynamic therapy

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00413B, Perspective
David Kessel
Failure of neoplastic cells to respond to conventional chemotherapy is usually associated with factors that limit access of drugs to subcellular sites, differences in cell-cycle kinetics or mutations leading to loss of drug-activation pathways or other processes that govern response factors.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Dec 2014 | 1:00 am CET

Protein-encapsulated bilirubin: paving the way to a useful probe for singlet oxygen

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00408F, Paper
Frederico M. Pimenta, Jan K. Jensen, Michael Etzerodt, Peter R. Ogilby
Oxygen- and singlet-oxygen-dependent parameters that characterize the behavior of bilirubin encapsulated in a protein have been quantified.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 18 Dec 2014 | 1:00 am CET

A study of the Fenton-mediated oxidation of methylene blue-cucurbit[n]uril complexes

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00362D, Paper
Tomas Fuenzalida, Denis Fuentealba
Methylene blue is protected from Fenton oxidation when encapsulated into cucurbit[7]uril or cucurbit[8]uril under dark or UVA irradiation. However, visible light enhances the degradation only when cucurbit[7]uril is present.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 17 Dec 2014 | 1:00 am CET

Photophysics of Acetophenone Interacting with DNA: Why the Road to Photosensitization is Open

Abstract

Deoxyribonucleic acid photosensitization, i.e. the photoinduced electron- or energy-transfer of chromophores interacting with DNA, is a crucial phenomenon that triggers important DNA lesions such as pyrimidine dimerization, even upon absorption of relatively low-energy radiation. Oxidative lesions may also be produced via the photoinduced production of reactive oxygen species. Aromatic ketones, and acetophenone in particular, are well known for their sensitization effects. In this contribution we model the structural and dynamical properties of the acetophenone/DNA aggregates as well as their spectroscopic and photophysical properties using high-level hybrid quantum mechanics/molecular mechanics methods. We show that the key steps of the photochemistry of acetophenone in gas phase are conserved in the macromolecular environment and thus an ultrafast singlet–triplet conversion of acetophenone is expected prior to the transfer to DNA.

Thumbnail image of graphical abstract

Using a combination of Molecular Dynamics and QM/MM modeling we have characterized stable interaction modes between acetophenone and DNA. The effects of the macromolecular environment on the acetophenone photophysics have been elucidated, confirming that it is still able to efficiently photosensitize DNA by energy transfer from triplet state. In particular this is due to the maintaining of the quasidegenerescence between the first two acetophenone triplet states that are moreover characterized by a high spin-orbit coupling with the ground state. Our work gives important insights in the triplet sensitization mechanism and on the effect of the environment.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 9:55 am CET

Recent Advances in the Application of Chlorophyll a Fluorescence from Photosystem II

Abstract

In the photosynthesis process, part of the absorbed photon energy in photosystem II (PSII) may be reemitted as chlorophyll a fluorescence (ChlF). Environmental and plant physiological changes affect the emission of ChlF, which makes ChlF a potentially useful tool to sense these changes. Volumes of research on ChlF are published each year and some published work has been controversial. To facilitate the application of ChlF, it is important to have a holistic picture of the field. This review summarizes ChlF applications published in the last 10 years.

Thumbnail image of graphical abstract

This review summarizes the literature on the applications of chlorophyll a fluorescence from photosystem II of plants published in the latest 10 years. Areas of application covered include: (1) plant senescence, damage, virus and diseases; (2) nutrient status; (3) salt stress; (4) chilling stress; (5) heat stress; (6) herbicides; (7) metal pollution; (8) aquatic ecosystems; (9) drought stress and (10) selection of stress-resistant species.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 9:55 am CET

MicroRNAs and Photocarcinogenesis

Abstract

As a new class of sequence-specific regulators of gene expression, the microRNAs (miRNA) form a regulatory network with growth factors and transcription factors participating in various biological processes. It is now being recognized that the various key processes involved in cancer induction are under the control of these small noncoding RNAs, which regulate ~30% of all human genes by targeting sequences in their 3′-untranslated regions. Photocarcinogenesis is a complex interplay of signaling events in the UV exposed human skin including DNA damage and repair, apoptosis, cell survival, mutations and the immune system. In this review, we have scrutinized the role of miRNAs in skin cancer biology focusing on the three most common types of skin cancer namely the basal cell carcinoma, squamous cell carcinoma and cutaneous malignant melanoma. An overview of these studies will be useful in gaining insights into the mechanisms of cancer development in the human skin. A better understanding of the functionality of miRNAs will have enormous implications to risk assessment, and to target interventions against signaling events involved in photocarcinogenesis.

Thumbnail image of graphical abstract

The modulation of gene expression in UV exposed human skin under the regulatory control of small noncoding miRNAs adds an additional layer of complexity to the process of skin carcinogenesis. An in-depth knowledge of the functionality of miRNAs in the human skin will have enormous implications to risk assessment, and to target interventions against signaling events involved in photocarcinogenesis.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 7:14 am CET

Light-Regulated MicroRNAs

Abstract

In addition to exposure to passive diurnal cycles of sunlight, humans are also subjected to intentional acute exposure to other types of electromagnetic radiation (EM). Understanding the molecular mechanisms involved in the physiological, pathological and therapeutic responses to exposure to radiation is an active area of research. With the advent of methods to readily catalog and identify patterns of changes in gene expression, many studies have reported changes in gene expression upon exposure of various human and mouse cells in vitro, whole experimental organisms such as mice and parts of human body. However, the molecular mechanisms underlying these broad ranging changes in gene expression are not yet fully understood. MicroRNAs, which are short, noncoding RNAs that regulate gene expression by targeting many messenger RNAs, are also emerging as important mediators of radiation-induced changes in gene expression and hence critical for the manifestation of light-induced cellular phenotypes and physiological responses. In this article, we review available knowledge on microRNAs implicated in responses to various forms of solar and other EM radiation. Based on this knowledge, we elaborate some unifying themes in the regulation and functions of some of these miRNAs.

Thumbnail image of graphical abstract

Exposure to different types of electromagnetic radiation is sensed by cells through various light-absorbing molecules such as opsins, cryptochromes and DNA. Activation of specific second messengers and signaling pathways lead to changes in expression of several genes including microRNAs (miRNA) and miRNA processing enzymes. Altered levels of miRNAs produce pleotropic effects by fine-tuning cellular levels of multitude of mRNAs leading to manifestation of EM radiation-induced phenotypes.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:44 pm CET

Beyond Xeroderma Pigmentosum: DNA Damage and Repair in an Ecological Context. A Tribute to James E. Cleaver

Abstract

The ability to repair DNA is a ubiquitous characteristic of life on Earth and all organisms possess similar mechanisms for dealing with DNA damage, an indication of a very early evolutionary origin for repair processes. James E. Cleaver's career (initiated in the early 1960s) has been devoted to the study of mammalian ultraviolet radiation (UVR) photobiology, specifically the molecular genetics of xeroderma pigmentosum and other human diseases caused by defects in DNA damage recognition and repair. This work by Jim and others has influenced the study of DNA damage and repair in a variety of taxa. Today, the field of DNA repair is enhancing our understanding of not only how to treat and prevent human disease, but is providing insights on the evolutionary history of life on Earth and how natural populations are coping with UVR-induced DNA damage from anthropogenic changes in the environment such as ozone depletion.

Thumbnail image of graphical abstract

Sunlight is one of the most ubiquitous hazards for life on Earth. Although some aspects of solar radiation are beneficial (e.g. photosynthesis, vision, vitamin D synthesis), the ultraviolet B (UVB) component causes substantial damage to DNA resulting in debilitating and lethal effects. All organisms are capable of repairing DNA photoproducts and repair pathways are remarkably similar. While DNA repair research often focuses on human diseases and the development of cancer; solar DNA damage is also an important component of ecosystem health and stability. This review provides an overview of DNA repair in non-mammalian taxa relative to ambient UVB stress.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:44 pm CET

The Efficient Photocatalytic Degradation of Methyl Tert-butyl Ether Under Pd/ZnO and Visible Light Irradiation

Abstract

Methyl tert-butyl ether is a commonly used fuel oxygenate that is present in gasoline. It was introduced to eliminate the use of leaded gasoline and to improve the octane quality because it aids in the complete combustion of fuel by supplying oxygen during the combustion process. Over the past decade, the use of MTBE has increased tremendously worldwide. For obvious reasons relating to accidental spillage, MTBE started to appear as an environmental and human health threat because of its nonbiodegradable nature and carcinogenic potential, respectively. In this work, MTBE was degraded with the help of an advanced oxidation process through the use of zinc oxide as a photocatalyst in the presence of visible light. A mixture of 200 mg of zinc oxide in 350 mL of 50 ppm MTBE aqueous solution was irradiated with visible light for a given time. The complete degradation of MTBE was recorded, and approximately 99% photocatalytic degradation of 100 ppm MTBE solution was observed. Additionally, the photoactivity of 1% Pd-doped ZnO was tested under similar conditions to understand the effect of Pd doping on ZnO. Our results obtained under visible light irradiation are very promising, and they could be further explored for the degradation of several nondegradable environmental pollutants.

Thumbnail image of graphical abstract

The photocatalytic degradation of aqueous MTBE solution was studied using zinc oxide as a photocatalyst. Complete MTBE removal was achieved within 9 h under visible light irradiation using ZnO particles. MTBE removal is attributed to the visible light excitation of the photocatalyst resulting in the generation of photoexcited electron/hole pairs. This method can be considered as an efficient and complete removal system of MTBE from water.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:38 pm CET

Minimum Exposure Limits and Measured Relationships Between the Vitamin D, Erythema and International Commission on Non-Ionizing Radiation Protection Solar Ultraviolet

Abstract

The International Commission on Non-Ionizing Radiation Protection (ICNIRP) has established guidelines for exposure to ultraviolet radiation in outdoor occupational settings. Spectrally weighted ICNIRP ultraviolet exposures received by the skin or eye in an 8 h period are limited to 30 J m−2. In this study, the time required to reach the ICNIRP exposure limit was measured daily in 10 min intervals upon a horizontal plane at a subtropical Australian latitude over a full year and compared with the effective Vitamin D dose received to one-quarter of the available skin surface area for all six Fitzpatrick skin types. The comparison of measured solar ultraviolet exposures for the full range of sky conditions in the 2009 measurement period, including a major September continental dust event, show a clear relationship between the weighted ICNIRP and the effective vitamin D dose. Our results show that the horizontal plane ICNIRP ultraviolet exposure may be used under these conditions to provide minimum guidelines for the healthy moderation of vitamin D, scalable to each of the six Fitzpatrick skin types.

Thumbnail image of graphical abstract

The relationship between vitamin D dose and the International Commission on Non-Ionizing Radiation Protection (ICNIRP) UV exposure is studied from measurements made in Southern Queensland, Australia. The measurements take into account all weather and atmospheric conditions including a major continental dust storm event (NASA MODIS Terra image, 23 September 2009). Personal minimum exposure guidelines for the optimal production of vitamin D are presented for each of the internationally recognized UV index ranges relative to the received ICNIRP exposure. The measured data show that the healthy production of vitamin D can be maintained at subtropical latitude without exceeding ICNIRP exposure guidelines.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:37 pm CET

Ultraviolet Index and Location are Important Determinants of Vitamin D Status in People with Human Immunodeficiency Virus

Abstract

This study aimed to document the vitamin D status of HIV-infected individuals across a wide latitude range in one country and to examine associated risk factors for low vitamin D. Using data from patients attending four HIV specialist clinics across a wide latitude range in Australia, we constructed logistic regression models to investigate risk factors associated with 25(OH)D < 75 nmol L−1. 1788 patients were included; 87% were male, 76% Caucasian and 72% on antiretroviral therapy. The proportion with 25(OH)D < 50 nmol L−1 was 27%, and <75 nmol L−1 was 54%. Living in Melbourne compared with Cairns (adjusted odds ratio (aOR) 3.30; 95% CI 2.18, 4.99, < 0.001) and non-Caucasian origin (aOR 2.82, 95% CI 2.12, 3.75, < 0.001) was associated with an increased risk, while extreme UV index compared with low UV index was associated with a reduced risk (aOR 0.33; 95% CI 0.20, 0.55, < 0.001) of 25(OH)D < 75 nmol L−1. In those with biochemistry available (n = 1117), antiretroviral therapy was associated with 25(OH)D < 75 nmol L−1; however, this association was modified by serum cholesterol status. Location and UV index were the strongest factors associated with 25(OH)D < 75 nmol L−1. Cholesterol, the product of an alternative steroid pathway with a common precursor steroid, modified the effect of antiretroviral therapy on serum 25(OH)D.

Thumbnail image of graphical abstract

Low vitamin D is commonly found in people with HIV. This figure presents the unadjusted proportions of people with 25(OH)D <75 nmol L−1 grouped by UV index categories and the four different study locations in Australia [Cairns (latitude 17°S), Nambour (27°S), Brisbane (28°S) and Melbourne (38°S)]. In this study, we describe these and other factors contributing to serum 25(OH)D levels in people with HIV in Australia. Antiretroviral therapy was also associated with 25(OH)D <75 nmol L−1 which appeared to be modified by cholesterol and warrants further exploration in future studies.

Quelle: Photochemistry and Photobiology | 9 Dec 2014 | 7:22 am CET

Transition from Charge-Transfer to Largely Locally Excited Exciplexes, from Structureless to Vibrationally Structured Emissions

Abstract

Exciplexes of 9,10-dicyanoanthracene (DCA) with alkylbenzene donors in cyclohexane show structureless emission spectra, typical of exciplexes with predominantly charge-transfer (CT) character, when the donor has a relatively low oxidation potential (Eox), e.g. hexamethylbenzene (HMB). With increasing Eox and stronger mixing with a locally excited (LE) state, vibrational structure begins to appear with 1,2,3,5-tetramethylbenzene and becomes prominent with p-xylene (p-Xy). A simple theoretical model reproduces the spectra and the radiative rate constants, and it reveals several surprises: Even in this nonpolar solvent, the fractional CT character of a highly mixed exciplex varies widely in response to fluctuations in the microscopic environment. Environments that favor the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. It is known that sparsely substituted benzene radical cations, e.g., p-Xy•+, are stabilized more in acetonitrile than the heavily substituted HMB•+. Remarkably, ion pairing with DCA•– in cyclohexane leads to even larger differences in the stabilization of these radical cations. The spectra of the low-Eox donors are almost identical except for displacements that approximately equal the differences in Eox, even though the exciplexes have varying degrees of CT character. These similarities result from compensation among several nonobvious, but quantified factors.

Thumbnail image of graphical abstract

Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (Eox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher Eox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-Eox spectra is illusory, resulting instead from several compensating factors.

Quelle: Photochemistry and Photobiology | 8 Dec 2014 | 7:01 am CET

Vitamin D and Skin Cancer

Abstract

Vitamin D signaling plays a key role in many important processes, including cellular proliferation, differentiation and apoptosis, immune regulation, hormone secretion and skeletal health. Furthermore, vitamin D production and supplementation have been shown to exert protective effects via an unknown signaling mechanism involving the vitamin D receptor (VDR) in several diseases and cancer types, including skin cancer. With over 3.5 million new diagnoses in 2 million patients annually, skin cancer is the most common cancer type in the United States. While ultraviolet B (UVB) radiation is the main etiologic factor for nonmelanoma skin cancer (NMSC), UVB also induces cutaneous vitamin D production. This paradox has been the subject of contradictory findings in the literature in regards to amount of sun exposure necessary for appropriate vitamin D production, as well as any beneficial or detrimental effects of vitamin D supplementation for disease prevention. Further clinical and epidemiological studies are necessary to elucidate the role of vitamin D in skin carcinogenesis.

Thumbnail image of graphical abstract

Vitamin D production and supplementation have been shown to exert protective effects in several diseases and cancers, including skin cancer. While ultraviolet B (UVB) radiation is the main etiologic factor for skin cancer, UVB also induces cutaneous vitamin D production. This paradox has been the subject of contradictory findings in the literature in regards to amount of sun exposure necessary for appropriate vitamin D production, as well as any beneficial or detrimental effects of vitamin D supplementation for disease prevention. Further clinical and epidemiological studies are necessary to elucidate the role of vitamin D in skin carcinogenesis.

Quelle: Photochemistry and Photobiology | 8 Dec 2014 | 6:55 am CET

Efficacy of Low-Dose Ultraviolet A-1 Phototherapy for Parapsoriasis/Early-Stage Mycosis Fungoides

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 8:01 am CET

In Vitro Photodynamic Inactivation Effects of Ru(II) Complexes on Clinical Methicillin-resistant Staphylococcus aureus Planktonic and Biofilm Cultures

Abstract

Photosensitizers (PSs) combined with light are able to generate antimicrobial effects. Ru(II) complexes have been recognized as a novel class of PSs. In this study, we investigated the effectiveness of photodynamic inactivation (PDI) mediated by three Ru(II) polypyridine complexes, 1–3, against four isolates of clinical methicillin-resistant Staphylococcus aureus (MRSA-1, MRSA-2, MRSA-3 and MRSA-4). In PDI of a planktonic culture of MRSA-1, compound 3 showed the highest efficacy, likely owing to its advantageous light absorption, 1O2 quantum yield and bacterial cellular binding. The PDI efficacy of 3 was further evaluated against all other strains and MRSA-1 biofilms. At appropriate PS concentrations, viability reduction of 100% or 96.83% was observed in planktonic or biofilm forms of MRSA, respectively. The mechanisms of action were investigated using negative staining transmission electron microscopy (TEM), confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM). It was demonstrated that PDI of planktonic bacteria was achieved primarily through damage to the cell envelope. Biofilms were eliminated through both the destruction of their structure and inactivation of the individual bacterial cells. In conclusion, Ru(II) complexes, especially 3, are potential candidates for the effective photodynamic control of MRSA infections.

Thumbnail image of graphical abstract

Photodynamic inactivation (PDI) is a compelling alternative treatment for infections, especially those caused by multidrug-resistant bacteria. In this study, a novel class of cationic photosensitizers, Ru(II) complexes, has been tested in their PDI effects against clinical methicillin-resistant Staphylococcus aureus (MRSA) strains, both in planktonic and biofilm cultures. Mechanisms of the PDI process were also investigated. It was demonstrated that PDI of planktonic bacteria was achieved primarily through damage to the cell envelope. Biofilms were eliminated through both the destruction of their structure and inactivation of the individual bacteria.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 7:59 am CET

Combination of Er:YAG Laser and CO2 Laser Treatment on Skin Tissue

Abstract

Skin is the most important organ in our body, as it protects us from external environmental effects. Study the ability of the skin to stretch and the histological examinations of irradiated tissues have significant values in scientific and medical applications. Only a few studies have been done to study the correlation between epidermis ablation and the changes that occur at dermal levels when using dual lasers in ablative resurfacing mode. The aim of this work is to determine this correlation and to estimate the effects of multiple pulses on induced collagen remodeling and the strength of skin exposed with dual lasers in an in vivo rat model. All laser exposures led to mark improvement in the skin's strength compared to their own controls. The histological investigation indicated that there was a thickness loss in the epidermis layer with the induction of deep collagen coagulation in the dermis layer as the dual laser pulses increased. Additionally, more collagen fibers were remolded in the treated samples by dual wavelengths. We conclude that by combining dual lasers with multiple pulses targeted at not only the epidermis layer of the skin, it could also induce some heat diffusion in the dermis layer which causes more coagulation of collagen fibers. The tensile results confirmed by our histological data demonstrate that the strength of irradiated skin with dual wavelengths increased more than using both lasers separately on the skin tissue since more collagen is induced.

Thumbnail image of graphical abstract

The skin is an important body-organ, protecting us from external environmental effects. Studies concerning the ability of skin to stretch and histological examinations of irradiated tissues have significant values for scientific and medical applications. Only few studies have been done to study the correlation between epidermis ablation and the changes that occur at dermal levels when using dual lasers in ablative resurfacing mode. The aim of this work is to determine this correlation and to estimate the effects of multiple pulses on induced collagen remodeling and the strength of skin exposed to dual lasers in an in vivo rat model.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 7:55 am CET

ß-Ga2O3 Nanorod Synthesis with a One-step Microwave Irradiation Hydrothermal Method and its Efficient Photocatalytic Degradation for Perfluorooctanoic Acid

Abstract

ß-Ga2O3 nanorod was first directly prepared by the microwave irradiation hydrothermal way without any subsequent heat treatments, and its characterizations were analyzed by X-ray diffraction (XRD), scanning electron microscope (SEM), high-resolution transmission electron microscope (HRTEM), UV–Vis diffuse reflection spectroscopy techniques, and also its photocatalytic degradation for perfluorooctanoic acid (PFOA) was investigated. XRD patterns revealed that ß-Ga2O3 crystallization increased with the enhancement of microwave power and the adding of active carbon (AC). PFOA, as an environmental and persistent pollutant, is hard decomposed by hydroxyl radicals (HO·); however, it is facilely destroyed by ß-Ga2O3 photocatalytic reaction in an anaerobic atmosphere. The important factors such as pH, ß-Ga2O3 dosage and bubbling atmosphere were researched, and the degradation and defluorination was 98.8% and 56.2%, respectively. Reductive atmosphere reveals that photoinduced electron may be the major reactant for PFOA. Furthermore, the degradation kinetics for PFOA was simulated and constant and half-life was calculated, respectively.

Thumbnail image of graphical abstract

ß-Ga2O3 was first synthesized via the microwave irradiation hydrothermal way and then was used to degrade PFOA under the UV light. Decomposition procedure involved the adsorption of PFOA on the surface of ß-Ga2O3 and the degradation. ß-Ga2O3 prepared by the microwave irradiation hydrothermal method owned the powerful photocatalytic degradation performance for PFOA and degradation kinetics constant was 0.0425 min−1.

Quelle: Photochemistry and Photobiology | 5 Dec 2014 | 7:54 am CET

UV Signature Mutations

Abstract

Sequencing complete tumor genomes and exomes has sparked the cancer field's interest in mutation signatures for identifying the tumor's carcinogen. This review and meta-analysis discusses signatures and their proper use. We first distinguish between a mutagen's canonical mutations—deviations from a random distribution of base changes to create a pattern typical of that mutagen—and the subset of signature mutations, which are unique to that mutagen and permit inference backward from mutations to mutagen. To verify UV signature mutations, we assembled literature datasets on cells exposed to UVC, UVB, UVA, or solar simulator light (SSL) and tested canonical UV mutation features as criteria for clustering datasets. A confirmed UV signature was: ≥60% of mutations are C[RIGHTWARDS ARROW]T at a dipyrimidine site, with ≥5% CC[RIGHTWARDS ARROW]TT. Other canonical features such as a bias for mutations on the nontranscribed strand or at the 3′ pyrimidine had limited application. The most robust classifier combined these features with criteria for the rarity of non-UV canonical mutations. In addition, several signatures proposed for specific UV wavelengths were limited to specific genes or species; UV's nonsignature mutations may cause melanoma BRAF mutations; and the mutagen for sunlight-related skin neoplasms may vary between continents.

Thumbnail image of graphical abstract

Inverse relationship of canonical mutation patterns and mutation signatures for inferring the mutagen from mutations. Two mutagens are illustrated. A mutagen's canonical mutations deviate from random base changes, establishing a pattern typical for that mutagen. Different mutagens can produce the same canonical mutations (non-informative mutations). Signature mutations are the subset of canonical mutations that, in addition, are unique to that mutagen and permit inference backward from mutations to mutagen. A mutagen therefore produces signature mutations plus non-informative mutations. The latter are real and are produced by the mutagen, but are not useful for identifying that mutagen or carcinogen.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study

Abstract

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.

Thumbnail image of graphical abstract

G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K+ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Following Oxygen Consumption in Singlet Oxygen Reactions via Changes in Sensitizer Phosphorescence

Abstract

This work reports an examination of singlet oxygen reactions with amino acid substrates by a method involving measurement of the change in phosphorescence intensity of the singlet oxygen sensitizer. The sensitizer, a Ru(II) bipyridyl complex covalently linked to pyrene, has long-lived phosphorescence in N2 purged aqueous solutions (τ0 ~ 20 μs) that is nearly completely quenched by oxygen in aerated solutions. Irradiation of the complex in water containing sub mM concentrations of histidine, tryptophan and methionine results in a dramatic, easily visible increase in the phosphorescence intensity over a period of 10–100 s. Rate constants for singlet oxygen oxidation of each of the substrates can be obtained by using changes in the phosphorescence intensity in initial rate kinetic analysis. Rate constants obtained in this way compare favorably with those reported in the literature. The method represents a very simple approach for obtaining rate constants for singlet oxygen reactions with various substrates and the kinetics can be extended to nonaqueous solvents.

Thumbnail image of graphical abstract

Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Oxidatively Generated Damage to Cellular DNA by UVB and UVA Radiation,

Abstract

This review article focuses on a critical survey of the main available information on the UVB and UVA oxidative reactions to cellular DNA as the result of direct interactions of UV photons, photosensitized pathways and biochemical responses including inflammation and bystander effects. UVA radiation appears to be much more efficient than UVB in inducing oxidatively generated damage to the bases and 2-deoxyribose moieties of DNA in isolated cells and skin. The UVA-induced generation of 8-oxo-7,8-dihydroguanine is mostly rationalized in terms of selective guanine oxidation by singlet oxygen generated through type II photosensitization mechanism. In addition, hydroxyl radical whose formation may be accounted for by metal-catalyzed Haber–Weiss reactions subsequent to the initial generation of superoxide anion radical contributes in a minor way to the DNA degradation. This leads to the formation of both oxidized purine and pyrimidine bases together with DNA single-strand breaks at the exclusion, however, of direct double-strand breaks. No evidence has been provided so far for the implication of delayed oxidative degradation pathways of cellular DNA. In that respect putative characteristic UVA-induced DNA damage could include single and more complex lesions arising from one-electron oxidation of the guanine base together with aldehyde adducts to amino-substituted nucleobases.

Thumbnail image of graphical abstract

UVA predominantly generates singlet oxygen that selectively oxidize guanine leading to 8-oxo-7,8-dihydroguanine. Superoxide anion radical (inline image) is also produced as the precursor of H2O2 and subsequently of highly reactive hydroxyl radical (OH) that induces oxidized bases and single-strand breaks. Both UVA and UVB are able to trigger delayed biochemical responses including activation of enzymes, inflammation and bystander effects. As a result inline image and nitric oxide are released leading to the formation of OH and peroxynitrite. The latter species is expected through reaction with CO2 to produce the carbonate anion radical, an efficient one-electron oxidant of guanine.

Quelle: Photochemistry and Photobiology | 27 Nov 2014 | 12:31 pm CET

Interspecific Variation in the Repair of UV Damaged DNA in the Genus Xiphophorus as a Factor in the Decline of the Rio Grande Platyfish

Abstract

The fish genus Xiphophorus consists of 26 species distributed along the eastern slopes of mountain ranges extending from northern Mexico to Belize and Nicaragua. We analyzed light-dependent repair of UV-induced DNA damage in at least two species from each of the four monophyletic Xiphophorus groups. We found that the northern platyfish had significantly reduced photoenzymatic repair compared to the other three groups, including the northern swordtails, southern platyfish and southern swordtails. All of the species of the northern platyfish, including the Marbled (meyeri), Northern (gordoni) and Monterrey Platyfish (couchianus) are the northernmost species in the genus and are the only three species in the genus that are currently found on the IUCN Red List of Threatened Species. Satellite data from the past 30 years (1979–2008) correlate greater increases in shorter wavelength UVB with higher latitudes within the Xiphophorus range. We suggest that, combined with other consequences of human population growth, anthropogenic deozonation resulting in a disproportionate increase in UVB in temperate latitudes may be a contributing factor in the decline and extirpation of the northern platyfish.

Thumbnail image of graphical abstract

Geographical distribution of 26 species of the genus Xiphophorus with three northern species is highlighted. The three species comprising the Rio Grande Platyfish are the only Xiphophorus listed on the IUCN Red List of Threatened Species and this clade as a whole displays significantly reduced DNA repair compared to the other species in the genus.

Quelle: Photochemistry and Photobiology | 25 Nov 2014 | 7:50 am CET

Effective Photoprotection of Human Skin against Infrared A Radiation by Topically Applied Antioxidants: Results from a Vehicle Controlled, Double-Blind, Randomized Study

Abstract

Infrared A radiation (IRA) from solar sunlight contributes to photoaging of human skin, e.g. by upregulating MMP-1 expression in dermal fibroblasts, indicating the need for photoprotection of human skin against IRA. Up to now, however, there has been no controlled study to show that effective protection of human skin against IRA radiation is possible. Here, we have conducted a randomized, controlled, double-blinded prospective study in 30 healthy volunteers to assess the capacity of an SPF 30 sunscreen versus the same sunscreen supplemented with an antioxidant cocktail containing grape seed extract, vitamin E, ubiquinone and vitamin C to protect human skin against IRA radiation-induced MMP-1 upregulation. As expected, exposure to IRA radiation significantly upregulated MMP-1 expression, as compared to unirradiated skin, and this response was significantly reduced, if the SPF30 sunscreen plus the antioxidant cocktail had been applied prior to IRA radiation. In contrast, treatment of human skin with the SPF30 sunscreen alone did not provide significant protection. These results indicate that topically applied antioxidants effectively protect human skin against IRA radiation and that regular sunscreens need to be supplemented with specific antioxidants in order to achieve IRA photoprotection.

Thumbnail image of graphical abstract

Topical application of an SPF30 sunscreen containing an antioxidant mixture consisting of grape seed extract, vitamin E, ubiquinone and vitamin C significantly protects human skin (n = 30) against IRA radiation-induced MMP-1 mRNA expression.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:12 am CET

o-Amino Analogs of Green Fluorescence Protein Chromophore: Photoisomerization, Photodimerization and Aggregation-induced Emission

Abstract

The photochemical properties of three o-amino analogs of the green fluorescence protein chromophore O0, O1 and O8 (o-ABDIs) have been investigated and compared with those of the m- and p-amino isomers (m-ABDIs and p-ABDIs) in solutions, aggregates, and the solid state. In aprotic solvents, the fluorescence competes with the Z [RIGHTWARDS ARROW] E photoisomerization for all cases, and the o-ABDIs display a fluorescence quantum efficiency of 1–6%, lying between the m-ABDIs of 5–48% and the p-ABDIs of < 0.1%. The fluorescence of both the o- and m-ABDIs is nearly quenched in protic solvents, attributable to the solvent–solute hydrogen bonding (SSHB) interactions. The phenomenon of aggregation-induced emission observed for O8 in poor solvents resembles the behavior of M8 as a consequence of exclusion of the SSHB interactions and restriction of internal rotation for molecules located inside the aggregates. The occurrence of [2 + 2] photodimerization for O0 in the solid state is unique among the ABDIs, and the X-ray crystal structures of O0 and the photodimer OD reveal the head-to-tail syn-oriented stereochemistry. Analysis on the X-ray crystal structures of O0, O1, M0, M1 and P0 shows that not only the pairwise topochemical geometry but also the columnar packing mode is important in determining the photodimerization reactivity.

Thumbnail image of graphical abstract

The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:10 am CET

Synthesis, Structure and Photophysical Properties of Ferrocenyl or Mixed Sandwich Cobaltocenyl Ester Linked meso-Tetratolylporphyrin Dyads

Abstract

We report here the design and synthesis of porphyrin–metallocene dyads consisting of a metallocene [either ferrocene or mixed sandwich η5-[C5H4(COOH)]Co(η4-C4Ph4) connected via an ester linkage at meso phenyl position of either free-base or zinc porphyrin. All these dyad systems were characterized by various spectroscopic and electrochemical methods. A dimeric form of this molecule was observed in the X-ray crystal structure of Zn-TTPCo. The absorption spectra of all four dyads indicated the absence of electronic interactions between porphyrin macrocycle and metallocene in the ground state. However, interestingly, in all four dyads, fluorescence emission of the porphyrin was quenched (19–55%) as compared to their monomeric units. The quenching was more pronounced in ferrocene derivatives rather than cobaltocenyl derivatives. The emission quenching can be attributed to the excited-state intramolecular photoinduced electron transfer from metallocene to singlet excited state of porphyrin and the electron-transfer rates (kET) were established in the range 1.51 × 108 to 1.11 × 109 s−1. They were found to be solvent dependent.

Thumbnail image of graphical abstract

We have designed two new porphyrin–metallocene dyads, in which either ferrocene or mixed cobaltocenyl connected at meso position of porphyrin through ester linkage. Ground-state properties showed that there exists minimum π−π interactions between porphyrin and metallocene. Singlet state properties reveal that there is a photoinduced electron transfer from metallocene to singlet state of porphyrin.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:08 am CET

DNA Damage Checkpoint Responses in the S Phase of Synchronized Diploid Human Fibroblasts

Abstract

We investigated the hypothesis that the strength of the activation of the intra-S DNA damage checkpoint varies within the S phase. Synchronized diploid human fibroblasts were exposed to either 0 or 2.5 J m−2 UVC in early, mid- and late-S phase. The endpoints measured were the following: (1) radio-resistant DNA synthesis (RDS), (2) induction of Chk1 phosphorylation, (3) initiation of new replicons and (4) length of replication tracks synthesized after irradiation. RDS analysis showed that global DNA synthesis was inhibited by approximately the same extent (30 ± 12%), regardless of when during S phase the fibroblasts were exposed to UVC. Western blot analysis revealed that the UVC-induced phosphorylation of checkpoint kinase 1 (Chk1) on serine 345 was high in early and mid S but 10-fold lower in late S. DNA fiber immunostaining studies indicated that the replication fork displacement rate decreased in irradiated cells at the three time points examined; however, replicon initiation was inhibited strongly in early and mid S, but this response was attenuated in late S. These results suggest that the intra-S checkpoint activated by UVC-induced DNA damage is not as robust toward the end of S phase in its inhibition of the latest firing origins in human fibroblasts.

Thumbnail image of graphical abstract

When cells are exposed to UV, the ATR-Chk1-Cdc7-Dbf4 arm of the intra-S checkpoint is activated. In early and mid S, the checkpoint response is robust and DNA origin initiation is inhibited. However, this DNA damage effect is not seen in late-S phase cells.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 9:52 am CET

In Situ FTIR Spectroscopy Study of the Photodegradation of Acetaldehyde and azo Dye Photobleaching on Bismuth-Modified TiO2

Abstract

The photocatalytic properties of bismuth-modified titania were studied by photobleaching of two aqueous azo dyes solutions (Reactive Black 5 and Acid Orange 7), and by photoinduced decomposition (PID) of acetaldehyde using in situ FTIR spectroscopy. Low bismuth doping concentrations up to 3 at.% is shown to lead to an increased photobleaching rate of both azo dyes solutions. Too high Bi dopant concentrations lead to less developed crystallite nanoparticles and exhibit weaker adsorption capacity. Bismuth doping altered the adsorption kinetics of acetaldehyde resulting in different surface products, and a modified photocatalytic reaction pathway was inferred.

Thumbnail image of graphical abstract

The low-temperature process avoiding organometallic precursors and nonwater solvents was employed to produce Bi-doped titania nanoparticles. This method proceeds via peroxotitanium complexes and can be easily used for solution doping. Acetaldehyde adsorption and its photoinduced degradation was observed by in situ FTIR spectroscopy and revealed different photocatalytic behavior of doped samples compared to pure TiO2.

Quelle: Photochemistry and Photobiology | 21 Nov 2014 | 6:59 am CET

Photoisomerization of cis-1,2-di(1-Methyl-2-naphthyl)ethene at 77 K in Glassy Media

Abstract

cis-1,2-Di(1-methyl-2-naphthyl)ethene, c-1,1, undergoes photoisomerization in methylcyclohexane, isopentane and diethyl ether/isopentane/ethanol glasses at 77 K. On 313 nm excitation the fluorescence of c-1,1 is replaced by fluorescence from t-1,1. Singular value decomposition reveals that the spectral matrices behave as two component systems suggesting conversion of a stable c-1,1 conformer to a stable t-1,1 conformer. However, the fluorescence spectra are λexc dependent. Analysis of global spectral matrices shows that c-1,1 is a mixture of two conformers, each of which gives one of four known t-1,1 conformers. The λexc dependence of the c-1,1 fluorescence spectrum is barely discernible. Structure assignments to the resolved fluorescence spectra are based on the principle of least motion and on calculated geometries, energy differences and spectra of the conformers. The relative shift of the c-1,1 conformer spectra is consistent with the shift of the calculated absorption spectra. The calculated structure of the most stable conformer of c-1,1 agrees well with the X-ray crystal structure. Due to large deviations of the naphthyl groups from the ethenic plane in the conformers of both c- and t-1,1 isomers, minimal motion of these bulky substituents accomplishes cis [RIGHTWARDS ARROW] trans interconversion by rotation about the central bond.

Thumbnail image of graphical abstract

One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

Quelle: Photochemistry and Photobiology | 21 Nov 2014 | 6:53 am CET

Analysis of Oxyluciferin Photoluminescence Pathways in Aqueous Solutions

Abstract

We evaluated the pKa values of oxyluciferin and its conjugate acids and bases theoretically with the help of experimental correction values, from which free energies for the first excited and the ground states of all the species were estimated. On the basis of these results, we calculated pH-dependent absorption spectra, where the relative absorption intensities of various species strongly depend on photoexcitation energy, and we further analyzed the photoluminescence pathways of oxyluciferin in aqueous solutions with various pH. In the case of 350 nm photoexcitation, in particular, experiments have shown that dominant emission color is green and it attenuates with pH decreasing, while blue (3 < pH < 8) and red (pH < 3) emissions appear. Our present results clarify the pathways of these photoluminescence depending on the pH values and thus should be useful in further analyses of photoluminescence pathways for other photoexcitation wavelength in comparison with experiments.

Thumbnail image of graphical abstract

The pathways for photoluminescence of oxyluciferin, which is well known as the emitter of firefly bioluminescence, in aqueous solutions of different pH values were theoretically investigated by estimating free energies of possible species with consideration of protonation/deprotonation.

Quelle: Photochemistry and Photobiology | 17 Nov 2014 | 10:02 am CET

Opsin Expression in Human Epidermal Skin

Abstract

Human skin is constantly exposed to solar light containing visible and ultraviolet radiation (UVR), a powerful skin carcinogen. UVR elicits cellular responses in epidermal cells via several mechanisms: direct absorption of short-wavelength UVR photons by DNA, oxidative damage caused by long-wavelength UVR, and, as we recently demonstrated, via a retinal-dependent G protein-coupled signaling pathway. Because the human epidermis is exposed to a wide range of light wavelengths, we investigated whether opsins, light-activated receptors that mediate photoreception in the eye, are expressed in epidermal skin to potentially serve as photosensors. Here we show that four opsins—OPN1-SW, OPN2, OPN3 and OPN5—are expressed in the two major human epidermal cell types, melanocytes and keratinocytes, and the mRNA expression profile of these opsins does not change in response to physiological UVR doses. We detected two OPN3 splice variants present in similar amounts in both cell types and three OPN5 splice isoforms, two of which encode truncated proteins. Notably, OPN2 and OPN3 mRNA were significantly more abundant than other opsins and encoded full-length proteins. Our results demonstrate that opsins are expressed in epidermal skin cells and suggest that they might initiate light–induced signaling pathways, possibly contributing to UVR phototransduction.

Thumbnail image of graphical abstract

Human epidermal skin is exposed to a wide range of light wavelengths, raising the question whether it uses opsins, light-activated receptors that mediate photoreception in the eye, as photosensors. We found that the two major human epidermal cell types, melanocytes and keratinocytes, express mRNA for four opsins—OPN1-SW, OPN2, OPN3 and OPN5. OPN2 and OPN3 mRNA were significantly more abundant than other opsins and encoded full-length proteins. Future studies will determine the function of these opsins in melanocytes and keratinocytes.

Quelle: Photochemistry and Photobiology | 13 Nov 2014 | 9:53 am CET

N4-Methylation of Cytosine Drastically Favors the Formation of (6-4) Photoproducts in a TCG Context

Abstract

Methylation of cytosine is a common biological process both in prokaryotic and eukaryotic cells. In addition to 5-methylcytosine (5mC), some bacterial species contain in their genome N4-methylcytosine (N4mC). Methylation at C5 has been shown to enhance the formation of pyrimidine dimeric photoproducts but nothing is known of the effect of N4 methylation on UV-induced DNA damage. In the present work, we compared the yield and the nature of bipyrimidine photoproducts induced in a series of trinucleotides exhibiting a TXG sequence where X is either T, C, 5mC or N4mC. HPLC associated to tandem mass spectrometry was used to quantify cyclobutane pyrimidine dimers (CPD), (6-4) photoproducts (64PP) and their Dewar valence isomer. Methylation at position N4 was found to drastically increase the reactivity of C upon exposure to both UVC and UVB and to favor the formation of 64PP. In contrast methylation at C5 increased the yield of CPD at the expense of 64PP. In addition, enhancement of photoreactivity by C5 methylation was much higher in the UVB than in the UVC range. These results show the drastic effect of the methylation site on the photochemistry of cytosine.

Thumbnail image of graphical abstract

Methylation of cytosine at position C5 is known to favor the formation of UVB-induced cyclobutane pyrimidine dimers in DNA. We report here that methylation at another position, namely the N4 exocyclic amino group, enhances the photoreactivity of cytosine both in the UVB and UVC range, and drastically increases the formation of (6-4) photoproducts.

Quelle: Photochemistry and Photobiology | 10 Nov 2014 | 7:26 am CET

Solar UV Irradiances Modulate Effects of Ocean Acidification on the Coccolithophorid Emiliania huxleyi

Abstract

Emiliania huxleyi, the most abundant coccolithophorid in the oceans, is naturally exposed to solar UV radiation (UVR, 280–400 nm) in addition to photosynthetically active radiation (PAR). We investigated the physiological responses of E. huxleyi to the present day and elevated CO2 (390 vs 1000 μatm; with pHNBS 8.20 vs 7.86) under indoor constant PAR and fluctuating solar radiation with or without UVR. Enrichment of CO2 stimulated the production rate of particulate organic carbon (POC) under constant PAR, but led to unchanged POC production under incident fluctuating solar radiation. The production rates of particulate inorganic carbon (PIC) as well as PIC/POC ratios were reduced under the elevated CO2, ocean acidification (OA) condition, regardless of PAR levels, and the presence of UVR. However, moderate levels of UVR increased PIC production rates and PIC/POC ratios. OA treatment interacted with UVR to influence the alga's physiological performance, leading to reduced specific growth rate in the presence of UVA (315–400 nm) and decreased quantum yield, along with enhanced nonphotochemical quenching, with addition of UVB (280–315 nm). The results clearly indicate that UV radiation needs to be invoked as a key stressor when considering the impacts of ocean acidification on E. huxleyi.

Thumbnail image of graphical abstract

The coccolithophorid Emiliania huxleyi may be calcifying less with progressive ocean acidification (OA). However, little is known about the physiological responses of E. huxleyi to OA under the natural solar irradiances, including UV radiation (280–400 nm, UVR). We found UVR could modulate the effects of OA on growth, photosynthesis, and calcification of E. huxleyi. This work emphasizes that UVR needs to be considered as a key factor when evaluating the impacts of OA on E. huxleyi.

Quelle: Photochemistry and Photobiology | 10 Nov 2014 | 7:26 am CET

Oculocutaneous Albinism in Sub-Saharan Africa: Adverse Sun-Associated Health Effects and Photoprotection

Abstract

Oculocutaneous albinism (OCA) is a genetically inherited autosomal recessive condition. Individuals with OCA lack melanin and therefore are susceptible to the harmful effects of solar ultraviolet radiation, including extreme sun sensitivity, photophobia and skin cancer. OCA is a grave public health issue in sub-Saharan Africa with a prevalence as high as 1 in 1000 in some tribes. This article considers the characteristics and prevalence of OCA in sub-Saharan African countries. Sun-induced adverse health effects in the skin and eyes of OCA individuals are reviewed. Sun exposure behavior and the use of photoprotection for the skin and eyes are discussed to highlight the major challenges experienced by these at-risk individuals and how these might be best resolved.

Thumbnail image of graphical abstract

Oculocutaneous albinism (OCA) is a genetically inherited autosomal recessive condition. Individuals with OCA lack melanin and therefore are susceptible to the harmful effects of solar ultraviolet radiation, including extreme sun sensitivity, photophobia and skin cancer. OCA is a grave public health issue in sub-Saharan Africa with a prevalence as high as one in 1000 in some tribes. Given the extent of adverse sun-related health effects experienced among individuals with OCA, commitment to prevention and treatment regimens should be raised as a priority to curb the impact of OCA as a major health problem in sub-Saharan Africa.

Quelle: Photochemistry and Photobiology | 8 Nov 2014 | 6:15 am CET

UVA Irradiation Induced Heme Oxygenase-1: A Novel Phototherapy for Morphea

Abstract

Long wave UVA radiation (340–400 nm) causes detrimental as well as beneficial effects on human skin. Studies of human skin fibroblasts irradiated with UVA demonstrate increased expression of both antifibrotic heme oxygenase-1 (HO-1) and matrix metalloproteinase 1 (MMP-1). The use of UVA-induced MMP-1 is well-studied in treating skin fibrotic conditions such as localized scleroderma, now called morphea. However, the role that UVA-induced HO-1 plays in phototherapy of morphea has not been characterized. In the present manuscript, we have illustrated and reviewed the biological function of HO-1 and the use of UVA1 wavebands (340–400 nm) for phototherapy; the potential use of HO-1 induction in UVA therapy of morphea is also discussed.

Thumbnail image of graphical abstract

The possible mechanism of UVA1-induced antifibrotic HO-1 and MMP-1 expressions in UVA1 phototherapy of morphea. Regulation of HMOX-1 gene upon UVA irradiation in human skin cells to induce cytoprotection: UVA1-induced ROS activation of Nrf2 and release of Keap1 for ubiquitination, translocation of Nrf2 to the nucleus to switch on the ARE‘s to evoke HO-1 expression. UVA1 generated ROS lead to the MMP-1 expression directly via ERK, TNFα, IL-1, and IL-6, or indirectly through HO-1 expression. Both antifibrotic effects of MMP-1 and HO-1 may, through TGFβ1, rebuild the ECM.

Quelle: Photochemistry and Photobiology | 8 Nov 2014 | 6:15 am CET

Development of Effective Skin Cancer Treatment and Prevention in Xeroderma Pigmentosum

Abstract

Xeroderma pigmentosum (XP) is a rare, recessively transmitted genetic disease characterized by increasingly marked dyspigmentation and xerosis (dryness) of sun-exposed tissues, especially skin. Skin cancers characteristically develop in sun-exposed sites at very much earlier ages than in the general population; these are often multiple and hundreds or even thousands may develop. Eight complementation groups have been identified. Seven groups, XP-A…G, are associated with defective genes encoding proteins involved in the nucleotide excision DNA repair (NER) pathway that recognizes and excises mutagenic changes induced in DNA by sunlight, the eighth group, XP-V, is associated with defective trans-lesion synthesis (TLS) bypassing such alterations. The dyspigmentation, xerosis, and eventually carcinogenesis in XP patients appear to be due to their cells’ failure to respond properly to these mutagenic DNA alterations, leading to mutations in skin cells. A subset of cases, especially those in some complementation groups, may develop neurological degeneration, which may be severe. However, in most XP patients in the past the multiple skin cancers have led to death at an early age due either to metastases or sepsis. Using either topical 5-fluorouracil or imiquimod, we have developed a protocol that effectively prevents most skin cancer development in XP patients.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 4:23 pm CET

Comparison of Templating Abilities of Urea and Thioruea During Photodimerization of Bipyridylethyelene and Stilbazole Crystals

Abstract

Photodimerization of cocrystals of four bispyridylethylenes and two stilbazoles with urea as a template in the solid state has been investigated following our success with thiourea. Four investigated olefins photodimerized quantitatively to a single dimer in the crystalline state only. The reactivity of urea–olefin crystals is understood on the basis of their packing arrangements in the crystalline state. In reactive crystals the adjacent reactive molecules are within 4.2 Å and parallel, whereas the unreactive ones have their adjacent molecules are farther than 4.6Å and nonparallel. Thus, with the knowledge of crystal packing the reactivity of urea–olefin crystals is predictable on the basis of Schmidt's topochemical postulates. The templating property of urea, similar to thiourea, derives from its ability to form hydrogen bonds with itself and the guest olefins. Despite the similarities in molecular structures of urea and thiourea their subtle electronic properties, yet to be fully understood, affect the crystal packing and consequently their reactivity in the crystalline state. Further work is needed to fully exploit the templating properties of urea.

Thumbnail image of graphical abstract

Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 2:22 pm CET

MC1R, Eumelanin and Pheomelanin: Their Role in Determining the Susceptibility to Skin Cancer

Abstract

Skin pigmentation is due to the accumulation of two types of melanin granules in the keratinocytes. Besides being the most potent blocker of ultraviolet radiation, the role of melanin in photoprotection is complex. This is because one type of melanin called eumelanin is UV absorbent, whereas the other, pheomelanin, is photounstable and may even promote carcinogenesis. Skin hyperpigmentation may be caused by stress or exposure to sunlight, which stimulates the release of α-melanocyte stimulating hormone (α-MSH) from damaged keratinocytes. Melanocortin 1 receptor (MC1R) is a key signaling molecule on melanocytes that responds to α-MSH by inducing expression of enzymes responsible for eumelanin synthesis. Persons with red hair have mutations in the MC1R causing its inactivation; this leads to a paucity of eumelanin production and makes red-heads more susceptible to skin cancer. Apart from its effects on melanin production, the α-MSH/MC1R signaling is also a potent anti-inflammatory pathway and has been shown to promote antimelanoma immunity. This review will focus on the role of MC1R in terms of its regulation of melanogenesis and influence on the immune system with respect to skin cancer susceptibility.

Thumbnail image of graphical abstract

Animal models indicate that the presence of pheomelanin is a required component for elaborating the increased melanoma risk in MCR1mutant mouse strains. This review examines the properties of pheomelanin and eumelanin with respect to the generation of toxic byproducts, depletion of scavenger pools, photoinstability and poor UVR absorption properties. Furthermore, a new understanding of MC1R function in cells of innate and adaptive immunity, suggests that the mutant receptor also causes altered responses, in terms of high inflammatory responses, contributing toward increasing the risk of melanoma development in light or red-headed individuals.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 2:17 pm CET

Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins

Abstract

The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's ketone linkers have been investigated by means of steady state and time-resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well-stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases.

Thumbnail image of graphical abstract

The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

Quelle: Photochemistry and Photobiology | 31 Oct 2014 | 5:46 am CET

Photostability of Cosmetic UV Filters on Mammalian Skin Under UV Exposure

Abstract

Previous studies showed that the common UV filter substances benzophenone-3 (BP–3), butyl methoxydibenzoylmethane (BM–DBM), octocrylene (OCR), ethylhexyl methoxycinnamate (EHMC), ethylhexyl salicylate (EHS) and ethylhexyl triazone (EHT) were able to react with amino side chains of different proteins in vitro. To transfer the results to mammalian skin conditions, sunscreen products were applied on both prepared fresh porcine skin and glass plates, followed by UV irradiation and the determination of depletion of the respective UV filters. Significantly lower recoveries of the UV filters extracted from skin samples than from glass plates indicated the additional reaction of the UV filters with skin constituents, when proteins will be the most important reactants. Among the products tested, BP-3 showed the greatest differences in recoveries between glass and skin samples of about 13% and 24% after 2 and 4 h of irradiation, respectively, followed by EHS > BM-DBM > OCR > EHMC > EHT. The obtained results raise the question, whether the common in vitro evaluations of sunscreens, using inert substrate materials like roughened quartz or polymethyl methacrylate (PMMA) plates are really suitable to fully replace in vivo methods, as they cannot include skin-typical reactions.

Thumbnail image of graphical abstract

Previous studies showed that common UV filter substances like BP-3, BM-DBM, EHS, OCR, EHMC and EHT were able to react with amino side chains of different proteins in vitro. The present work confirms that also in the case of real skin samples, differences in the recoveries could be observed when sunscreen samples were irradiated on either glass plates or pig skin, indicating the occurrence of certain skin-typical reactions, as the formation of protein adducts. The results were in good accordance with a recently developed HPTLC screening method, indicating a different photocontact allergenic potential of the UV filters.

Quelle: Photochemistry and Photobiology | 25 Oct 2014 | 9:40 am CEST

Highly Efficient Photodegradation of Organic Pollutants Assisted by Sonoluminescence

Abstract

The mechanism of the photodegradation of azo dyes via ultrasonication is studied using a combination of the high-performance liquid chromatography and UV–vis spectroscopy with detailed analysis of the kinetics. Based on the kinetics studies of the sonodegradation, it was proposed that the degradation of azo dyes was a multistage process that involved: (1) the direct attack of azo bonds and phenyl rings of dyes by the sonochemically formed reactive oxygen species; (2) the activation of semiconductor particles by the light emitted during cavitation and the triggering of the photocatalytic pathways of dye degradation and (3) increase of the adsorption capacity of the semiconductor particles due to the sonomechanically induced interparticle collisions. The detailed kinetics study can help in following an effective process up-scaling. It was demonstrated that extremely short pulses of light flashes in a cavitated mixture activated the surface of photocatalysts and significantly enhanced dye degradation processes.

Thumbnail image of graphical abstract

The kinetics of dye degradation via ultrasonication was studied. It was shown that Light emitted in cavitated liquid was essential for initiation of the photoreactions on the surface of the semiconductor particles. Direct attack of dye molecules by sonochemically formed reactive oxygen species causes relatively slow degradation of azo dyes. The mechanism of ultrasound-assisted degradation of azo dyes is mostly based on the activation of photocatalysts by sonoluminescence.

Quelle: Photochemistry and Photobiology | 20 Oct 2014 | 12:55 pm CEST

Inspection of Feasible Calibration Conditions for UV Radiometer Detectors with the KI/KIO3 Actinometer

Abstract

UV radiometers are widely employed for irradiance measurements, but their periodical calibrations not only induce an extra cost but also are time-consuming. In this study, the KI/KIO3 actinometer was applied to calibrate UV radiometer detectors at 254 nm with a quasi-collimated beam apparatus equipped with a low-pressure UV lamp, and feasible calibration conditions were identified. Results indicate that a washer constraining the UV light was indispensable, while the size (10 or 50 mL) of a beaker containing the actinometer solution had little influence when a proper washer was used. The absorption or reflection of UV light by the internal beaker wall led to an underestimation or overestimation of the irradiance determined by the KI/KIO3 actinometer, respectively. The proper range of the washer internal diameter could be obtained via mathematical analysis. A radiometer with a longer service time showed a greater calibration factor. To minimize the interference from the inner wall reflection of the collimating tube, calibrations should be conducted at positions far enough away from the tube bottom. This study demonstrates that after the feasible calibration conditions are identified, the KI/KIO3 actinometer can be applied readily to calibrate UV radiometer detectors at 254 nm.

Thumbnail image of graphical abstract

Under feasible calibration conditions, the KI/KIO3 actinometer can be easily applied to calibrate UV radiometer detectors at 254 nm in a quasi-collimated beam apparatus in ordinary laboratories, which saves the cost and time for periodic detector recalibrations.

Quelle: Photochemistry and Photobiology | 18 Oct 2014 | 12:18 pm CEST

Interleukin-17 Mediated Inflammatory Responses Are Required for Ultraviolet Radiation-Induced Immune Suppression

Abstract

Ultraviolet radiation (UVR) induces immunosuppression and is a major factor for development of skin cancer. Numerous efforts have been made to determine mechanisms for UVR-induced immunosuppression and to develop strategies for prevention and treatment of UVR-induced cancers. In the current study, we use IL-17 receptor (IL-17R) deficient mice to examine whether IL-17 mediated responses have a role in UVB (290–320)-induced immunosuppression of contact hypersensitivity responses. Results demonstrate that IL-17 mediated responses are required for UVB-induced immunosuppression of contact hypersensitivity responses. The systemic immune suppression and development of regulatory T cells are inhibited in UVB-treated IL-17R deficient mice compared to wild-type animals. The deficiency in IL-17R inhibits the infiltration and development of a tolerogenic myeloid cell population in UVB-treated skin, which expresses CD11b and Gr-1 and produces reactive oxygen species. We speculate that the development of the tolerogenic myeloid cells is dependent on IL-17-induced chemokines and inflammatory mediators in UVB-treated skin. The inhibition of the tolerogenic myeloid cells may be attributed to the suppression of regulatory T cells in UVR-treated IL-17R−/− mice. The findings may be exploited to new strategies for prevention and treatment of UVR-induced skin diseases and cancers.

Thumbnail image of graphical abstract

Ultraviolet radiation (UVR) causes immune suppression which is associated with an increased risk of skin cancers. Exposure to UVR induces inflammation with an increased level of interleukin-17 in the skin. Our data show that blockade of interleukin-17 inhibits UVR-induced immune suppression. The lack of interleukin-17-mediated inflammation reduces the infiltration and development of suppressive myeloid cells in the ultraviolet-irradiated skin and development of regulatory T cells. The results implicate that interleukin-17 is an important mediator for UVR-induced immune suppression and may be a target for development of new strategies for the prevention of UVR-induced skin cancers.

Quelle: Photochemistry and Photobiology | 13 Oct 2014 | 1:18 pm CEST

Fisetin Inhibits UVB-induced Cutaneous Inflammation and Activation of PI3K/AKT/NFκB Signaling Pathways in SKH-1 Hairless Mice

Abstract

Solar ultraviolet B (UVB) radiation has been shown to induce inflammation, DNA damage, p53 mutations and alterations in signaling pathways eventually leading to skin cancer. In this study, we investigated whether fisetin reduces inflammatory responses and modulates PI3K/AKT/NFκB cell survival signaling pathways in UVB-exposed SKH-1 hairless mouse skin. Mice were exposed to 180 mJ cm−2 of UVB radiation on alternate days for a total of seven exposures, and fisetin (250 and 500 nmol) was applied topically after 15 min of each UVB exposure. Fisetin treatment to UVB-exposed mice resulted in decreased hyperplasia and reduced infiltration of inflammatory cells. Fisetin treatment also reduced inflammatory mediators such as COX-2, PGE2 as well as its receptors (EP1–EP4) and MPO activity. Furthermore, fisetin reduced the level of inflammatory cytokines TNFα, IL-1β and IL-6 in UVB-exposed skin. Fisetin treatment also reduced cell proliferation markers as well as DNA damage as evidenced by increased expression of p53 and p21 proteins. Further studies revealed that fisetin inhibited UVB-induced expression of PI3K, phosphorylation of AKT and activation of the NFκB signaling pathway in mouse skin. Overall, these data suggest that fisetin may be useful against UVB-induced cutaneous inflammation and DNA damage.

Thumbnail image of graphical abstract

Exposure to solar UVB radiation has been implicated as the main cause for skin cancer. In this study, we investigated whether fisetin, a flavonoid abundantly present in fruits and vegetables, reduces inflammatory responses and modulates PI3K/AKT/NFκB cell survival signaling pathways in UVB-exposed SKH-1 hairless mouse skin. Our data demonstrated that topical application of fisetin to SKH-1 mice inhibited UVB-induced inflammation and proliferation by modulating PI3K/AKT/NFκB signaling pathways. In addition, fisetin treatment augmented UVB-induced protein expression of p53 and p21 as well as reduced DNA damage caused by UVB exposure. Overall, these findings suggest that fisetin could be developed as a novel photochemopreventive agent.

Quelle: Photochemistry and Photobiology | 7 Oct 2014 | 1:24 pm CEST

Photo-Wolff Rearrangement of 2-Diazo-1,2-naphthoquinone: Stern–Volmer Analysis of the Stepwise Reaction Pathway

Abstract

2-Diazo-1,2-naphthoquinone (1) and its derivatives are the photoactive components in Novolak photoresists. A femtosecond infrared study has established that the photoreaction of 1 proceeds largely by a concerted Wolff rearrangement yielding the ketene 1H-inden-1-ylidene-methanone (3) within 300 fs after excitation, but earlier trapping studies gave evidence for a minor reaction path via a carbene intermediate 1-oxo-2(1H)-naphthalenylidene (2) with a lifetime of about 10 ps. Here, we provide a quantitative assessment of the stepwise pathway by Stern–Volmer analysis of the trapping of 2 by methanol to yield 2-methoxy-1-naphthol (4). We conclude that the lifetime of the carbene 2 is at least 200 ps. Moreover, [3 + 2]cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was observed. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Thumbnail image of graphical abstract

A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Quelle: Photochemistry and Photobiology | 30 Sep 2014 | 12:24 pm CEST

Proanthocyanidins from Grape Seeds Inhibit UV–Radiation-Induced Immune Suppression in Mice: Detection and Analysis of Molecular and Cellular Targets

Abstract

Ultraviolet (UV)–radiation-induced immunosuppression has been linked with the risk of skin carcinogenesis. Approximately, 2 million new cases of skin cancers, including melanoma and nonmelanoma, diagnosed each year in the USA and therefore have a tremendous bad impact on public health. Dietary phytochemicals are promising options for the development of effective strategy for the prevention of photodamaging effects of UV radiation including the risk of skin cancer. Grape seed proanthocyanidins (GSPs) are such phytochemicals. Dietary administration of GSPs with AIN76A control diet significantly inhibits UV-induced skin tumor development as well as suppression of immune system. UV-induced suppression of immune system is commonly determined using contact hypersensitivity (CHS) model which is a prototype of T–cell-mediated immune response. We present evidence that inhibition of UV-induced suppression of immune system by GSPs is mediated through: (i) the alterations in immunoregulatory cytokines, interleukin (IL)-10 and IL-12, (ii) DNA repair, (iii) stimulation of effector T cells and (iv) DNA repair-dependent functional activation of dendritic cells in mouse model. These information have important implications for the use of GSPs as a dietary supplement in chemoprevention of UV-induced immunosuppression as well as photocarcinogenesis.

Thumbnail image of graphical abstract

Prevention of UV–radiation-induced immunosuppression by dietary grape seed proanthocyanidins is mediated through: (i) alterations in immunoregulatory cytokines, such as, IL-10 and IL-12, (ii) stimulation of DNA repair and (iii) DNA repair-dependent functional activation of dendritic cells in mice.

Quelle: Photochemistry and Photobiology | 8 Sep 2014 | 8:42 am CEST

A New Series of Fluorescent Indicators for Super Acids

Abstract

The photophysical properties of fluorescent Hammett acidity indicator derived from 3,4,5,6-tetrahydrobis(pyrido[3,2-g]indolo)[2,3-a:3′,2′-j]acridine (1a), 6-bis(pyrido[3,2-g]indol-2′-yl)pyridine (1b) and their analogues have been investigated in sulfuric acid solutions by means of absorption, fluorimetry, relaxation dynamics and computational approach. These new indicators undergo a reversible protonation process in the Hammett acidity range of H0 < 0, accompanied by a drastic increase of the bright blue-green (1a) or yellow (1b) fluorescence intensity upon increasing the acidity. For 1a in H2SO4, the emission yield increases as large as 200 folds from pH = −0.41 to the Hammett acidity range of −5.17, the results of which are rationalized by a much increase of the steric hindrance upon third protonation toward the central pyridinic site, together with their accompanied changes of electronic configuration from charge transfer to a delocalized ππ* character in the lowest lying excited state. The combination of 1a and 1b renders a wide and linear range of H0 measurement from −1.2 to −5.1 detected by highly intensive fluorescence.

Thumbnail image of graphical abstract

A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pKa as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

Quelle: Photochemistry and Photobiology | 6 Sep 2014 | 2:11 pm CEST

Effect of Immunosuppressants Tacrolimus and Mycophenolate Mofetil on the Keratinocyte UVB Response

Abstract

Nonmelanoma skin cancer, derived from epidermal keratinocytes, is the most common malignancy in organ transplant recipients, causes serious morbidity and mortality, and is strongly associated with solar ultraviolet (UV) exposure. Preventing and treating skin cancer in these individuals has been extraordinarily challenging. Following organ transplantation, the immunosuppressants are used to prevent graft rejection. Until now, immunosuppression has been assumed to be the major factor leading to skin cancer in this setting. However, the mechanism of skin carcinogenesis in organ transplant recipients has not been understood to date; specifically, it remains unknown whether these cancers are immunosuppression-dependent or -independent. In particular, it remains poorly understood what is the mechanistic carcinogenic action of the newer generation of immunosuppressants including tacrolimus and mycophenolate mofetil (MMF). Here, we show that tacrolimus and MMF impairs UVB-induced DNA damage repair and apoptosis in human epidermal keratinocytes. In addition, tacrolimus inhibits UVB-induced checkpoint signaling. However, MMF had no effect. Our findings have demonstrated that tacrolimus and MMF compromises proper UVB response in keratinocytes, suggesting an immunosuppression-independent mechanism in the tumor-promoting action of these immunosuppressants.

Thumbnail image of graphical abstract

This study investigated the effects of the newer generation of immunosuppressants including tacrolimus and mycophenolate mofetil (MMF) on keratinocyte UVB response. Tacrolimus and MMF impairs UVB-induced DNA repair and apoptosis in human keratinocytes. In addition, tacrolimus inhibits UVB-induced checkpoint signaling, while MMF had no effect. Our findings have demonstrated that tacrolimus and MMF compromises proper keratinocyte UVB response, suggesting an immunosuppression-independent mechanism in the tumor-promoting action of these immunosuppressants.

Quelle: Photochemistry and Photobiology | 12 Aug 2014 | 8:36 am CEST

ROS and p53 in Regulation of UVB-induced HDM2 Alternative Splicing

Abstract

Alternative splicing plays an important role in proteasome diversity and gene expression regulation in eukaryotic cells. Hdm2, the human homolog of mdm2 (murine double minute oncogene 2), is known to be an oncogene as its role in suppression of p53. Hdm2 alternative splicing, occurs in both tumor and normal tissues, is believed to be a response of cells for cellular stress, and thus modulate p53 activity. Therefore, understanding the regulation of hdm2 splicing is critical in elucidating the mechanisms of tumor development and progression. In this study, we determined the effect of ultraviolet B light (UVB) on alternative splicing of hdm2. Our data indicated that UVB (50 mJ cm−2) alone is not a good inducer of alternative splicing of hdm2. The less effectiveness could be due to the induction of ROS and p53 by UVB because removing ROS by L-NAC (10 mm) in p53 null cells could lead to alternative splicing of hdm2 upon UVB irradiation.

Thumbnail image of graphical abstract

Hdm2, the human homologue of mdm2 (murine double minute oncogene 2), is an oncogene for its role in suppression of p53. Hdm2 alternative splicing, occurs in both tumor and normal tissues, is suggested to be a response of cells for cellular stress, and thus modulate p53 activity. In this study, we demonstrated that UVB is weaker inducer of alternative splicing than UVC is. We also provided evidences that the UV-induced alternative splicing is promoted by DNA-damage, but suppressed by ROS formation and p53 activity of the irradiated cells.

Quelle: Photochemistry and Photobiology | 26 Jul 2014 | 7:02 am CEST

Xeroderma Pigmentosum in the United Kingdom

Abstract

The seminal discovery by James Cleaver of defective DNA repair in xeroderma pigmentosum (XP) opened up an ever-expanding field of DNA repair-related disorders. In addition, it put XP on the map and has led to improved diagnosis, care and management of affected patients. In the United Kingdom, we recently established a multidisciplinary specialist clinic for XP patients. All XP patients in the United Kingdom are able to visit the clinic where they are examined and advised by a team of specialists with detailed knowledge of the different aspects of XP.

Thumbnail image of graphical abstract

Early diagnosis and rigorous protection from daylight can completely prevent the skin problems in XP. Patient XP59BR (left) has had poor protection from daylight and has developed many skin cancers. In contrast, patient XPJCLO was diagnosed in his first year of life, has been rigorously protected from sunlight and has not developed any significant skin lesions. Curiously, despite having similar mutations in the XPD gene, XP59BR has no severe neurological problems, whereas XPJCLO has shown features of neurological degeneration since the age of 2. Photographs published with consent of patient or their family.

Quelle: Photochemistry and Photobiology | 14 Jul 2014 | 7:37 am CEST

Effect of Light on Expression of Clock Genes in Xenopus laevis Melanophores

Abstract

Light-dark cycles are considered important cues to entrain biological clocks. A feedback loop of clock gene transcription and translation is the molecular basis underlying the mechanism of both central and peripheral clocks. Xenopus laevis embryonic melanophores respond to light with melanin granule dispersion, response possibly mediated by the photopigment melanopsin. In order to test whether light modulates clock gene expression in Xenopus melanophores, we used qPCR to evaluate the relative mRNA levels of Per1, Per2, Clock and Bmal1 in cultured melanophores exposed to light-dark (LD) cycle or constant darkness (DD). LD cycles elicited temporal changes in the expression of Per1, Per2 and Bmal1. A 10-min pulse of blue light was able to increase the expression of Per1 and Per2. Red light had no effect on the expression of these clock genes. These data suggest the participation of a blue-wavelength sensitive pigment in the light-dark cycle-mediated oscillation of the endogenous clock. Our results add an important contribution to the emerging field of peripheral clocks, which in non-mammalian vertebrates have been mostly studied in Drosophila and Danio rerio. Within this context, we show that Xenopus laevis melanophores, which have already led to melanopsin discovery, represent an ideal model to understanding circadian rhythms.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 26 Dec 2013 | 1:09 pm CET




 


Sonstige Hinweise:


Ueber diese Seite:

 

Urheber und Verantwortlich fuer die Inhalte der verlinkten Artikel sind die in den Quellen genannten Anbieter.

 

Hinweise zur Veroeffentlichung Ihrer Pressemitteilung im Bereich Chemie und angrenzende Fachgebiete

Update:

08.10.2009

Thema:

Chronologische Liste mit Fachartikeln zum Thema Photochemie.

Benutzerdefinierte Suche

Internetchemie Copyright: 2007 - 2009 A. J.