[ Sitemap ] [ Kontakt ] [ Impressum ] [ ] Volltext Suche Chemie


Home


Weiteres zum Thema:

Photochemie

Buecher zum Thema


Themenbezogene Artikel

- Biolumineszenz

- Chemie, allgemein

- Fluoreszenz

- Fotosynthese

Weitere Themenbereiche

English Version


Verwandte Themen:

Physikalische Chemie


Aktuelles

Chemie Nachrichten

Stellenmarkt Chemie

Chemie Konferenzen


Chemie A bis Z

Index Chemie

Chemikalien

Internetchemie Lexikon

Produkte und Firmen


About Internetchemie

Internetchemie

Impressum

Service




Photochemie - Neueste Forschungsartikel der Fachverlage


 
Aktuelle Fachartikel zur Photochemie und Photobiologie, sortiert nach Erscheinungsdatum.

Die Urheberrechte und Veroeffentlichungsrechte der in der nachfolgenden Liste aufgefuehrten Fachartikel liegen bei den jeweiligen Verlagen, die am Ende des jeweiligen Artikels als Quelle genannt werden. Diese sind auch fuer die Inhalte verantwortlich.

Hinweise zur Veroeffentlichung Ihrer Pressmitteilung unter Internetchemie.Info entnehmen Sie bitte der entsprechenden Info-Seite.

Diese Seite koennen Sie mit folgender Tastenkombination nach Stichwoertern durchsuchen: <STRG> und <F>.


Auf dieser Seite beruecksichtige naturwissenschaftliche Journale:


Photochemical & Photobiological Sciences - published by The Royal Society of Chemistry -
PPS meets the growing information needs of scientists working in the areas of photochemistry and photobiology, and indeed, encourages a synergism between these two important research areas. This international journal is published monthly on behalf of the European Photochemistry Association (EPA), the European Society for Photobiology (ESP), the Asia and Oceania Society for Photobiology (AOSP) and the Korean Society of Photoscience (KSP), and is available in both print and electronic formats.

Photochemistry and Photobiology - published by Wiley-Interscience -
... publishes original research articles and reviews on current topics in photoscience.



Aktuelle wissenschaftliche Fachartikel der genannten Journale:


Spray deposited [small beta]-Bi2O3 nanostructured films with visible photocatalytic activity for solar water treatment

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00367E, Paper
Karen Barrera-Mota, Monserrat Bizarro, Micaela Castellino, Alberto Tagliaferro, Aracely Hernandez, Sandra E. Rodil
Bismuth oxide thin films were obtained by spray pyrolysis. The films were photocatalytically active under visible light, giving good degradation when incorporated into a solar reactor prototype.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Apr 2015 | 1:00 am CEST

Protein profiles of Escherichia coli and Staphylococcus warneri are altered by photosensitization with cationic porphyrins

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00194J, Paper
Eliana Alves, Cristina Esteves, Antonio Correia, Angela Cunha, Maria Amparo Ferreira Faustino, Graca Neves, Adelaide Almeida
Oxidative stress induced by photodynamic treatment of microbial cells causes irreversible damages on vital cellular components such as proteins. Photodynamic inactivation (PDI) of bacteria, a promising therapeutic approach for the...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Apr 2015 | 1:00 am CEST

Hybrid Membrane of Agarose and Lanthanide Coordination Polymer: a Selective and Sensitive Fe3+ Sensor

Abstract

A new hybrid membrane was prepared by a facile method, based on a highly luminescent lanthanide coordination polymer and agarose. The soft membrane was characterized by FT-IR, PXRD, SEM and luminescence. It is found that the soft membrane is a highly selective and sensitive sensor, among 19 metal ion solutions of Fe3+, Mg2+, Li+, Ca2+, Zn2+, Cu2+, Ba2+, Mn2+, Ru3+, Cr3+, Ag+, Sr2+, Cd2+, Na+, Ni2+, Pb2+, Fe2+, Hg2+ and Ca2+, only Fe3+ quench the luminescence. The sensing results can be distinguished by naked eye in the daylight or by irradiation of a portable UV light at the scene. Mechanism study reveal the sensing is due to the decomposition of the coordination polymer 1 which induced by slow permeation of Fe3+. Further studies found anions of BO3-, CO32-, H2PO4-, Br-, Cl-, ClO4-, H2PO4-, I-, IO3- and NO3- will not quench the luminescence of the hybrid membrane, which imply that other anions in water would not disturb the detection result.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 20 Apr 2015 | 6:02 am CEST

Minimizing Concentration of Sodium Hypochlorite in Root Canal Irrigation by Combination of Ultrasonic Irrigation with Photodynamic Treatment

Abstract

Concentration of sodium hypochlorite (NaOCl) is positively correlated to its effectiveness in root canal disinfection but negatively correlated to its biocompatibility. The objective of this in vitro study was to compare the bactericidal effects among ultrasonic irrigation with different concentration of NaOCl alone or together with photodynamic treatment (PDT) against Enterococcus faecalis (E. faecalis) in infected root canals. One hundred and twenty bovine root canals contaminated with E. faecalis were randomly distributed into 12 groups treated with different disinfection methods: PDT, ultrasonic irrigation with NaOCl at different concentrations (0.5%, 1.0%, 2.0%, 2.5% and 5.25%), and ultrasonic irrigation with NaOCl at different concentrations plus PDT. Data of microorganism load were collected before and after disinfection and analyzed by one-way ANOVA and LSD tests. Significantly enhanced antibacterial effects were noticed in groups treated by PDT plus 2.0% or 2.5% NaOCl irrigation (P < 0.05). No statistical differences existed in bactericidal efficacy among groups of PDT plus ultrasonic irrigation with 2.0%, 2.5% or 5.25% NaOCl, and ultrasonic irrigation with 5.25% NaOCl alone (P > 0.05). Our study confirmed the feasibility to reduce the concentration of NaOCl to a safer level while maintaining its antibacterial efficiency through synergistic effect of PDT with NaOCl ultrasonic irrigation.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 20 Apr 2015 | 5:56 am CEST

A critical approach toward resonance-assistance in the intramolecular hydrogen bond interaction of 3,5-diiodosalicylic acid: A spectroscopic and computational investigation

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C5PP00033E, Paper
Saptarshi Mukherjee, Bijan Kumar Paul, Narayani Ghosh, Ramakanta Mondal
The photophysics of a prospective drug molecule 3,5-Diiodosalicylic acid (3,5-DISA) having a wide spectrum of biological and medicinal applications have been investigated using spectroscopic techniques and computational analyses. The remarkably...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 17 Apr 2015 | 1:00 am CEST

An Optimized Firefly Luciferase Bioluminescent Assay for the Analysis of Free Fatty Acids

Abstract

A firefly luciferase (LUC)-based bioluminescent assay for total free fatty acids (FFA) is presented. It is based on LUC's capability of converting FFA into fatty acyl-adenylates with consumption of adenosine 5’-triphosphate (ATP). Since ATP is a co-substrate in LUC's bioluminescent reaction, together with firefly d-luciferin (d-LH2) and atmospheric oxygen (O2), any reduction in the assay's ATP content will lead to a decrease in the bioluminescent signal, which is proportional to the amount of FFA. Using FFA mixtures containing myristic (14:0), palmitic (16:0), stearic (18:0), oleic (18:1) and arachidonic acid (20:4) in ethanol, the assay was optimized through statistical experimental design methodology, namely fractional factorial (screening) and central composite (optimization) designs. The optimized method requires 2 μL of sample per tube in a final reaction volume of 50 μL. It is linear in the concentration range from 1 to 20 μM, with limits of detection (LOD) and quantitation (LOQ) of 1.3 and 4.5 μM, respectively. The method proved to be simple to perform, demands low reagent volumes, it is sensitive and robust and may be adapted to high-throughput screening.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 16 Apr 2015 | 2:56 pm CEST

Stepwise photoconversion of an artificial light-harvesting array built from extended BODIPY units

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00021A, Paper
Anthony Harriman, Patrycja Stachelek, Alexandra Sutter, Raymond Ziessel
The target light-harvesting antennae can be used to sensitize a solar cell in order to improve its performance.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 16 Apr 2015 | 1:00 am CEST

Promotion of Pro-Apoptotic Signals by Lysosomal Photodamage

Abstract

We previously reported that low level lysosomal photodamage enhanced the efficacy of subsequent mitochondrial photodamage, resulting in a substantial promotion of apoptotic cell death. We now extend our analysis of the sequential PDT protocol to include two additional lysosomal-targeting photosensitizers. These agents, because of enhanced permeability, are more potent than the agent (N-aspartyl chlorin E6, NPe6) used in the initial study. Addition of the cell-permeable cysteine protease inhibitor E-64d and calcium chelator BAPTA-AM almost completely suppressed sequential PDT-induced loss of mitochondrial membrane potential, activation of procaspases-3 and -7 and loss of colony formation. These inhibitors did not, however, suppress the pro-apoptotic effect of a BH3 mimetic or mitochondrial photodamage. Knockdowns of ATG7 or ATG5, proteins normally associated with autophagy, suppressed photokilling induced by the sequential PDT protocol. These effects appear to be independent of the autophagic process since pharmacological inhibition of autophagy offered no such protection. Effects of ATG7 and ATG5 knockdown may reflect the role that ATG7 plays in regulating lysosome permeability, and the likelihood that a proteolytic fragment of ATG5 amplifies mitochondrial pro-apoptotic processes. Our results suggest that low-dose photodamage that sequentially targets lysosomes and mitochondria may offer significant advantages over the use of single photosensitizers.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 15 Apr 2015 | 8:52 am CEST

Ketoprofen as Photoinitiator for Anionic Polymerization

Photochem. Photobiol. Sci., 2015, Accepted Manuscript
DOI: 10.1039/C4PP00454J, Paper
Yu-Hsuan Wang, Peter Wan
A new photoinitiating system for anionic polymerization of acrylates based on the efficient photodecarboxylation of Ketoprofen (1) and related derivatives 3 and 4 that generate the corresponding carbanion intermediates is...
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 15 Apr 2015 | 1:00 am CEST

Early changes in staurosporine-induced differentiated RGC-5 cells indicate cellular injury response to nonlethal blue light exposure

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00456F, Paper
Pei Zhang, Chen Huang, Wei Wang, Minshu Wang
In vitro nonlethal blue light exposure led to increases in oxidative stress and mitochondrial content staurosporine-differentiated RGC-5 cells, which as the early response to lower dose of blue light exposure.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 14 Apr 2015 | 1:00 am CEST

Light-mediated DNA Repair Prevents UVB-induced Cell Cycle Arrest in Embryos of the Crustacean Macrobrachium olfersi

Abstract

High levels of ultraviolet-B (UVB) radiation can negatively affect aquatic animals. Macrobrachium olfersi is a prawn that lives in clear freshwaters and during the breeding season, females carry eggs in an external brood pouch. Therefore, we hypothesize that eggs are also exposed to environmental UVB radiation. The aim of this study was to investigate whether UVB radiation induces DNA damage and compromises cell-cycle in embryos of M. olfersi. In laboratory, UVB irradiance (310 mW.cm−2) that embryos receive in the natural environment was simulated. After irradiation, embryos were kept under different light conditions in order to recognize the presence of cell repair. UVB radiation induces DNA damage, specifically thymine dimers. After 48h of UVB exposure, a significant decrease in the level of these dimers was observed in embryos kept under visible light while it remained constant in the dark. Moreover, under visible light and darkness, a decrease in proliferation was observed after 48h of irradiation. An increase in PCNA expression and decrease in p53 expression were observed after, respectively, 1h and 48h of exposure. Our results showed that UVB radiation disturbs the cell-cycle and induces DNA damage in M. olfersi embryos. However, under visible light these embryos showed successful DNA repair.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 13 Apr 2015 | 6:49 pm CEST

On the Dual Phosphorescence of Xanthone and Chromone in Glassy Hydrocarbon Hosts

Abstract

Trace quantities of hydrogen-bonding impurities in otherwise highly purified and dried glassy hydrocarbon matrices at 77 K can modify the relative triplet state energy levels, and hence the photophysical properties of two aromatic ketones, xanthone and chromone, to the extent that the intrinsic spectroscopic properties are obscured. The intrinsic spectroscopic properties of each are revealed in multicrystalline n-alkane Shpol'skii matrices, and also can be observed in rigorously purified and dried hydrocarbon glasses at 77 K. The extreme sensitivity to stoichiometric, and even substoichiometric quantities of hydrogen-bonding impurities arises from the near-degeneracy of the two lowest-lying triplet states, and the sensitive nature of the n[RIGHTWARDS ARROW]π* blueshift phenomena to specific hydrogen-bonding interactions.

Thumbnail image of graphical abstract

Trace quantities of hydrogen-bonding impurities in otherwise highly purified and dried glassy hydrocarbon matrices at 77 K modify the relative triplet state energy levels, and hence the photophysical properties of two aromatic ketones, xanthone and chromone, to the extent that the intrinsic spectroscopic properties are obscured. The intrinsic spectroscopic properties of each are revealed in multicrystalline n-alkane Shpol'skii matrices, and also in rigorously purified and dried hydrocarbon glasses at 77 K. The extreme sensitivity to substoichiometric quantities of hydrogen-bonding impurities arises from the near-degeneracy of the two lowest-lying triplet states, and the sensitive nature of the n[RIGHTWARDS ARROW]π* blueshift phenomena to specific hydrogen-bonding interactions.

Quelle: Photochemistry and Photobiology | 11 Apr 2015 | 6:52 am CEST

Utilization of PARAFAC-Modeled Excitation-Emission Matrix (EEM) Fluorescence Spectroscopy to Identify Biogeochemical Processing of Dissolved Organic Matter in a Northern Peatland

Abstract

In this study, we contrast the fluorescent properties of dissolved organic matter (DOM) in fens and bogs in a Northern Minnesota peatland using excitation emission matrix fluorescence spectroscopy with parallel factor analysis (EEM-PARAFAC). EEM-PARAFAC identified four humic-like components and one protein-like component and the dynamics of each were evaluated based on their distribution with depth as well as across sites differing in hydrology and major biological species. The PARAFAC-EEM experiments were supported by dissolved organic carbon measurements (DOC), optical spectroscopy (UV-Vis), and compositional characterization by ultrahigh resolution Fourier transform ion cyclotron resonance mass spectroscopy (FT-ICR MS). The FT-ICR MS data indicate that metabolism in peatlands reduces the molecular weights of individual components of DOM, and oxygen-rich less aromatic molecules are selectively biodegraded. Our data suggest that different hydrologic and biological conditions within the larger peat ecosystem drive molecular changes in DOM, resulting in distinctly different chemical compositions and unique fluorescent fingerprints. PARAFAC modeling of EEM data coupled with ultrahigh resolution FT-ICR MS has the potential to provide significant molecular-based information on DOM composition that will support efforts to better understand the composition, sources, and diagenetic status of DOM from different terrestrial and aquatic systems.

Thumbnail image of graphical abstract

Spectral characteristics of five components of Dissolved Organic Matter (DOM) in Glacial Lake Agassiz peatland porewaters identified by PARAFAC modeling of EEM fluorescence spectra. Color contours reflect intensities expressed in Quinine Sulfate Equivalent (QSE) units; blue low, red high. The relative loadings of these components to total fluorescence vary as a function of peat type and depth, and appear to be a function of the quality of the DOM and the active microbial community present.

Quelle: Photochemistry and Photobiology | 9 Apr 2015 | 6:47 am CEST

Photo and Chemical Reduction of Copper onto Anatase-Type TiO2 Nanoparticles with Enhanced Surface Hydroxyl Groups as Efficient Visible Light Photocatalysts

Abstract

In this study, the photocatalytic efficiency of anatase-type TiO2 nanoparticles synthesized using the sol–gel low-temperature method, were enhanced by a combined process of copper reduction and surface hydroxyl groups enhancement. UV–light-assisted photo and NaBH4-assisted chemical reduction methods were used for deposition of copper onto TiO2. The surface hydroxyl groups of TiO2 were enhanced with the assistance of NaOH modification. The prepared catalysts were immobilized on glass plates and used as the fixed-bed systems for the removal of phenazopyridine as a model drug contaminant under visible light irradiation. NaOH-modified Cu/TiO2 nanoparticles demonstrated higher photocatalytic efficiency than that of pure TiO2 due to the extending of the charge carriers lifetime and enhancement of the adsorption capacity of TiO2 toward phenazopyridine. The relationship of structure and performance of prepared nanoparticles has been established by using various techniques, such as XRD, XPS, TEM, EDX, XRF, TGA, DRS and PL. The effects of preparation variables, including copper content, reducing agents rate (NaBH4 concentration and UV light intensity) and NaOH concentration were investigated on the photocatalytic efficiency of NaOH-modified Cu/TiO2 nanoparticles.

Thumbnail image of graphical abstract

The visible–light-induced photocatalytic activity of anatase-type TiO2 nanoparticles was enhanced by a combined process of copper reduction and surface hydroxyl groups enhancement.

Quelle: Photochemistry and Photobiology | 8 Apr 2015 | 10:51 am CEST

Effects of Silencing Heme Biosynthesis Enzymes on 5-Aminolevulinic Acid-mediated Protoporphyrin IX Fluorescence and Photodynamic Therapy

Abstract

Aminolevulinic acid (ALA)-mediated protoporphyrin IX (PpIX) production is being explored for tumor fluorescence imaging and photodynamic therapy (PDT). As a prodrug, ALA is converted in heme biosynthesis pathway to PpIX with fluorescent and photosensitizing properties. To better understand the role of heme biosynthesis enzymes in ALA-mediated PpIX fluorescence and PDT efficacy, we used lentiviral shRNA to silence the expression of porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD) and ferrochelatase (FECH) in SkBr3 human breast cancer cells. PBGS and PBGD are the first two cytosolic enzymes involved in PpIX biosynthesis, and FECH is the enzyme responsible for converting PpIX to heme. PpIX fluorescence was examined by flow cytometry and confocal fluorescence microscopy. Cytotoxicity was assessed after ALA-mediated PDT. Silencing PBGS or PBGD significantly reduced ALA-stimulated PpIX fluorescence, whereas silencing FECH elevated basal and ALA-stimulated PpIX fluorescence. However, compared with vector control cells, the ratio of ALA-stimulated fluorescence to basal fluorescence without ALA was significantly reduced in all knockdown cell lines. PBGS or PBGD knockdown cells exhibited significant resistance to ALA-PDT, while increased sensitivity to ALA-PDT was found in FECH knockdown cells. These results demonstrate the importance of PBGS, PBGD and FECH in ALA-mediated PpIX fluorescence and PDT efficacy.

Thumbnail image of graphical abstract

Three heme biosynthesis enzymes porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD) and ferrochelatase (FECH) were silenced to evaluate its effects on aminolevulinic acid (ALA)-mediated protoporphyrin IX (PpIX) fluorescence and photodynamic therapy (PDT) in human breast cancer SkBr3 cells. Knockdown of PBGS or PBGD significantly decreased ALA-PpIX fluorescence and rendered resistance to PDT. In contrast, silence of FECH greatly sensitized cells to PDT by increasing ALA-PpIX production.

Quelle: Photochemistry and Photobiology | 8 Apr 2015 | 9:51 am CEST

Effects of Enhanced UV-B Radiation on Biochemical Traits in Postharvest Flowers of Medicinal Chrysanthemum

Abstract

This article reported UV-B radiation effects on biochemical traits in postharvest flowers of chrysanthemum. The experiment included six levels of UV-B radiation (UV0, 0 μW cm−2; UV50, 50 μW cm−2; UV200, 200 μW cm−2; UV400, 400 μW cm−2; UV600, 600 μW cm−2 and UV800, 800 μW cm−2). Enhanced UV-B radiation significantly increased hydrogen peroxide content (except for UV50), but did not evidently affect malondialdehyde content in flowers. Chlorophyll b and total chlorophyll content were significantly increased by UV600 and UV800. UV400 and UV600 significantly increased anthocyanins, carotenoids and UV-B absorbing compounds content, and the activities of phenylalanine ammonia lyase (PAL) and cinnamic acid-4-hydroxylase (C4H) over the control. 4-coumarate CoA ligase (4CL) activity was significantly decreased by enhanced UV-B radiation (except for UV50). The relationships between UV-B radiation intensities and the activities of secondary metabolism enzymes were best described by a second-order polynomial. The R2 values for UV-B radiation intensities and the activities of PAL, C4H and 4CL were 0.8361, 0.5437 and 0.8025, respectively. The results indicated that enhanced UV-B radiation could promote secondary metabolism processes in postharvest flowers, which might be beneficial for the accumulation of medically active ingredients in medicinal plants. The optimal UV-B radiation intensities in the study were between UV400-UV600.

Thumbnail image of graphical abstract

This article mainly studied enhanced UV-B radiation effects on biochemical traits in postharvest flowers of chrysanthemum. The experiment included six levels of UV-B radiation (UV0, 0 μW cm−2; UV50, 50 μW cm−2; UV200, 200 μW cm−2; UV400, 400 μW cm−2; UV600, 600 μW cm−2 and UV800, 800 μW cm−2). The results indicated that UV-B effects on biochemical traits in postharvest flowers depended on UV-B radiation intensities, and enhanced UV-B radiation could promote secondary metabolism processes in postharvest flowers.

Quelle: Photochemistry and Photobiology | 6 Apr 2015 | 7:24 am CEST

Photodegradation of Hydrophobic Pyridineketoximes in Toluene and Heptane

Abstract

The goal of the research was to study the reactivity of the hydrophobic 2- and 3-pyridineketoximes under exposure to UV-VIS light. The photodegradation was conducted in both toluene and heptane for 10 h under atmosphere of argon. Ten-hour irradiation experiments demonstrated that the pyridineketoximes underwent the facile E-Z photoisomerization, photo-Beckmann rearrangement, and to a lesser extent, the photosubstitution to the pyridine ring. From LC-MS and NMR analysis of the irradiated solutions, it was found that the photosubstitution proceeded to give the corresponding 6-substituted 2- or 3-pyridylketoxime via the replacement of the ring hydrogen by the benzyl or heptyl group. The photo-Beckmann rearrangement led to the formation of the corresponding amides, but also other products formed in the photo-decomposition reaction.

Thumbnail image of graphical abstract

This study presents the photochemical reactivity of the hydrophobic 2- and 3- pyridineketoximes – (Z)-oxime of 1-(2-pyridyl)tridecan-1-one and (E)-oxime of 1-(3-pyridyl)tridecan-1-one – in toluene and heptane as solvent. The data indicated that the both oximes underwent significant E-Z photoisomerization, photo-Beckmann rearrangement and the photosubstitution to the pyridine ring. For example, in aliphatic solvent, the photo-Beckmann rearrangement of (Z)-oxime of 1-(2-pyridyl)tridecan-1-one led to the formation of 2-aminopyridine, eicosan-8-one and N-dodecylpyridine-2-carboxamide. In the case of (E)-oxime of 1-(3-pyridyl)tridecan-1-one, the photodegradation led to formation of N-dodecylpyridine-3-carboxamide, 3-aminopyridine and eicosan-8-one.

Quelle: Photochemistry and Photobiology | 6 Apr 2015 | 7:03 am CEST

Effects of PAR and UV Radiation on the Structural and Functional Integrity of Phycocyanin, Phycoerythrin and Allophycocyanin Isolated from the Marine Cyanobacterium Lyngbya sp. A09DM

Abstract

An in vitro analysis of the effects of photosynthetically active and ultraviolet radiations was executed to assess the photostability of biologically relevant pigments phycocyanin (PC), phycoerythrin (PE) and allophycocyanin (APC) isolated from Lyngbya sp. A09DM. Ultraviolet (UV) irradiances significantly affected the integrity of PC, PE and APC; however, PAR showed least effect. UV radiation affected the bilin chromophores covalently attached to phycobiliproteins (PBPs). Almost complete elimination of the chromophore bands associated with α- and β-subunit of PE and APC occurred after 4 h of UV-B exposure. After 5 h of UV-B exposure, the content of PC, PE and APC decreased by 51.65%, 96.8% and 96.53%, respectively. Contrary to PAR and UV-A radiation, a severe decrease in fluorescence of all PBPs was observed under UV-B irradiation. The fluorescence activity of extracted PBP was gradually inhibited immediately after 15–30 min of UV-B exposure. In comparison to the PC, the fluorescence properties of PE and APC were severely lost under UV-B radiation. Moreover, the present study indicates that UV-B radiation can damage the structural and functional integrity of phycobiliproteins leading to the loss of their ecological and biological functions.

Thumbnail image of graphical abstract

UV irradiances significantly affected the structural and functional integrity of biologically relevant molecules phycocyanin (PC, λmax: 615 nm), phycoerythrin (PE, λmax: 563 nm) and allophycocyanin (APC, λmax: 652 nm). UV radiation also affected the bilin chromophores covalently attached to phycobiliproteins (PBPs). The spectroscopic as well as sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) analyses of the PC, PE and APC of Lyngbya sp. showed a marked decrease in the PBPs content with an increase in UV exposure time. In comparison to the PC, the fluorescence properties of PE and APC were severely lost under UV-B radiation.

Quelle: Photochemistry and Photobiology | 2 Apr 2015 | 12:02 pm CEST

Susceptibility of Ureaplasma urealyticum to Methylene Blue-Mediated Photodynamic Antimicrobial Chemotherapy: An in vitro Study

Abstract

The aim of this study was to detect the susceptibility of Ureaplasma urealyticum to methylene blue-mediated photodynamic antimicrobial chemotherapy (PACT). Three U. urealyticum strains including the standard serotype 1 and 5, and a clinically collected strain were used in this study. Strains were first incubated in 96-well culture plates in the presence of methylene blue with decreasing concentrations (from 1 to 0.015625 mg mL−1) for 20 or 60 min, and then submitted to irradiation with a light-emitting diode laser with a power density of 100 mW cm−2 for 8, 17, 34 or 68 min. Regrowth of the strains was performed soon after irradiation. A significant inactivation effect was observed after PACT. Longer incubation time induced more extensive inactivation of U. urealyticum. No difference in response to PACT was observed between the two biovars of U. urealyticum. It was concluded that PACT had a significant inactivation effect on U. urealyticum, and it might be a promising alternative treatment for resistant U. urealyticum infections.

Thumbnail image of graphical abstract

This work investigated the susceptibility of Ureaplasma urealyticum to methylene blue-mediated photodynamic antimicrobial chemotherapy (PACT). When U. urealyticum strains were incubated with methylene blue for 20 or 60 min, irradiation with 633 nm red light led to a significant inactivation effect on the growth of U. urealyticum. Higher light dose, or longer incubation time with methylene blue induced more extensive inactivation of U. urealyticum. Thus, PACT provides a promising alternative treatment for resistant U. urealyticum infections.

Quelle: Photochemistry and Photobiology | 2 Apr 2015 | 12:01 pm CEST

Photosensitizing Activity of Endogenous Eye Lens Chromophores: An Attempt to Unravel Their Contributions to Photo-Aging and Cataract Disease

Abstract

UVA-visible light has been proposed as a risk factor in the photo-aging of the human eye lens, as well as in the etiology of cataract disease. There is accumulating evidence indicating that photosensitizing reactions mediated by endogenous chromophores, which are generated during human eye lens aging, can play an important role in the generation of these processes. These reactions can lead to protein impairment by inducing non-enzymatic post-translational modifications such as protein oxidation and crosslinking. Although numerous chromophores have been characterized as both bound to human eye lens proteins and as unbound low-molecular-mass compounds, their contribution to eye lens photoaging and cataract disease is not completely understood. In this article we discuss the photochemical contribution of UV-filters derived from tryptophan catabolism and advanced glycation end products (AGEs) to human eye lens aging and cataract disease. We also discuss the recently described photosensitizing capacity of chromophores derived from newly discovered glucose and ascorbate degradation as a parallel pathway to their role in AGEs generation.

Thumbnail image of graphical abstract

Human eye lens aging is accompanied with the generation of numerous chromophores, which can be found at higher concentrations in cataractous lenses. In this review we discuss the presence and UVA-visible photosensitizing capacity of the main families of chromophores associated with the etiology and progression of human cataract disease.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:57 am CET

Improved Spectral Coverage and Fluorescence Quenching in Donor–acceptor Systems Involving Indolo[3-2-b]carbazole and Boron-dipyrromethene or Diketopyrrolopyrrole

Abstract

A novel π-conjugated triad and a polymer incorporating indolo[3,2-b]-carbazole (ICZ) and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) were synthesized via a Sonogashira coupling. Compared to the parent BODIPY the absorption and fluorescence spectrum were for both compounds broader and redshifted. The redshift of the fluorescence and the decrease of the fluorescence quantum yield and decay time upon increasing solvent polarity were attributed to the formation of a partial charge-transfer state. Upon excitation in the ICZ absorption band the ICZ fluorescence was quenched in both compounds mainly due to energy transfer to the BODIPY moiety. In a similar ICZ–π–DPP polymer (where DPP is diketopyrrolopyrrole), a smaller redshift of the absorption and fluorescence spectra compared to the parent DPP was observed. A less efficient quenching of the ICZ fluorescence in the ICZ–π–DPP polymer could be related to the unfavorable orientation of the transition dipoles of ICZ and DPP. The rate constant for energy transfer was for all compounds an order of magnitude smaller than predicted by Förster theory. While in a solid film of the triad a further redshift of the absorption maximum of nearly 100 nm was observed, no such shift was observed for the ICZ–π–BODIPY polymer.

Thumbnail image of graphical abstract

We report synthesis and studies of organic compounds incorporating indolo[3,2-b]-carbazole (ICZ), and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) or diketopyrrolopyrrole (DPP). The spectroscopic studies suggest stronger interaction between ICZ and BODIPY in both ground and excited states as well as more efficient energy transfer from ICZ to BODIPY, compared to those of the ICZ-DPP compound, which could be related to the unfavorable orientation of the transition dipoles of ICZ and DPP chromophores. Furthermore, in a solid film of the ICZ–π–BODIPY triad an aggregate of the triad molecules was observed, resulting in a redshift of the absorption maximum (~100 nm) relative to a solution.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:55 am CET

High Final Energy of Low-Level Gallium Arsenide Laser Therapy Enhances Skeletal Muscle Recovery without a Positive Effect on Collagen Remodeling

Abstract

The aim of this study was to evaluate the effects of a Gallium Arsenide (GaAs) laser, using a high final energy of 4.8 J, during muscle regeneration after cryoinjury. Thirty Wistar rats were divided into three groups: Control (C, n = 10); Injured (I, n = 10) and Injured and laser treated (Injured/LLLT, n = 10). The cryoinjury was induced in the central region of the tibialis anterior muscle (TA). The applications of the laser (904 nm, 50 mW average power) were initiated 24 h after injury, at energy density of 69 J cm−1 for 48 s, for 5 days, to two points of the lesion. Twenty-four hours after the final application, the TA muscle was removed and frozen in liquid nitrogen to assess the general muscle morphology and the gene expression of TNF-α, TGF-β, MyoD, and Myogenin. The Injured/LLLT group presented a higher number of regenerating fibers and fewer degenerating fibers (P < 0.05) without changes in the collagen remodeling. In addition, the Injured/LLLT group presented a significant decrease in the expression of TNF-α and myogenin compared to the injured group (P < 0.05). The results suggest that the GaAs laser, using a high final energy after cryoinjury, promotes muscle recovery without changing the collagen remodeling in the muscle extracellular matrix.

Thumbnail image of graphical abstract

This study investigated the effects of low-level laser therapy (LLLT) at a high final energy (4.8 J) during muscle regeneration after cryoinjury. Gallium Arsenide (GaAs, 904 nm) laser applied for 5 days in two points of the lesion resulted in a significant decrease in the TNF-α and myogenin, without change in the TGF-β gene expression. The Injured/LLLT group presented a higher number of regenerating fibers and fewer degenerating fibers without changes in the collagen remodeling. The results suggest that the GaAs laser at a high final energy (4.8 J) promotes muscle recovery without changing the collagen remodeling.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:54 am CET

A Novel Microsensor for Measuring Angular Distribution of Radiative Intensity

Abstract

This article presents the design, construction and characterization of a novel type of light probe for measuring the angular radiance distribution of light fields. The differential acceptance angle (DAA) probe can resolve the directionality of a light field in environments with steep light gradients, such as microbial mats, without the need to remove, reorient, and reinsert the probe, a clear advantage over prior techniques. The probe consists of an inner irradiance sensor inside a concentric, moveable light-absorbing sheath. The radiative intensity in a specific zenith direction can be calculated by comparing the irradiance onto the sensor at different acceptance angles. We used this probe to measure the angular radiance distribution of two sample light fields, and observed good agreement with a conventional radiance probe. The DAA probe will aid researchers in understanding light transfer physics in dense microbial communities and expedite validation of numerical radiative transfer models for these environments.

Thumbnail image of graphical abstract

Measurement of the directional dependence of radiative intensity is essential for understanding light transport in microbial mats, plant leaves, soils and phototrophic biofilms. Previously, measuring the directional intensity in these environments required inserting a field radiance probe with a small acceptance angle into a tissue at multiple angles, which required significant time and labor. This paper presents a novel differential acceptance angle (DAA) light probe, which can measure the directional intensity in light fields from a single location without reorienting the probe. We discuss the construction of the DAA probe and its performance compared to a conventional field radiance probe.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:37 am CET

Endogenous Retinoic Acid Required to Maintain the Epidermis Following Ultraviolet Light Exposure in SKH-1 Hairless Mice

Abstract

Ultraviolet light B (UVB) exposure induces cutaneous squamous cell carcinoma (cSCC), one of the most prevalent human cancers. Reoccurrence of cSCC in high-risk patients is prevented by oral retinoids. But oral retinoid treatment causes significant side effects; and patients develop retinoid resistance. Exactly how retinoids prevent UVB-induced cSCC is currently not well understood. Retinoid resistance blocks mechanistic studies in the leading mouse model of cSCC, the UVB-exposed SKH-1 hairless mouse. To begin to understand the role of retinoids in UVB-induced cSCC we first examined the localization pattern of key retinoid metabolism proteins by immunohistochemistry 48 h after UVB treatment of female SKH-1 mice. We next inhibited retinoic acid (RA) synthesis immediately after UVB exposure. Acute UVB increased RA synthesis, signaling and degradation proteins in the stratum granulosum. Some of these proteins changed their localization; while other proteins just increased in intensity. In contrast, acute UVB reduced the retinoid storage protein lectin:retinol acyltransferase (LRAT) in the epidermis. Inhibiting RA synthesis disrupted the epidermis and impaired differentiation. These data suggest that repair of the epidermis after acute UVB exposure requires endogenous RA synthesis.

Thumbnail image of graphical abstract

Ultraviolet light B (UVB) exposure alters the expression of some retinoid metabolism proteins; but an analysis of the complete system in vivo is lacking. We analyzed the expression of retinoid metabolism proteins by immunohistochemistry 48 h after UVB treatment of SKH-1 mice. Acute UVB localized retinoic acid (RA) synthesis and signaling to the upper stratum granulosum; localized RA degradation to the lower stratum granulosum and stratum spinosum; and reduced retinoid storage. Inhibition of RA synthesis by disulfiram damaged the epidermis (image). These results suggest that endogenously synthesized RA is important in epidermal differentiation and repair following UVB exposure.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:34 am CET

Steady-State Spectroscopy of the 2-(N-methylacetimidoyl)-1-naphthol Molecule

Abstract

The steady-state spectroscopy of 2-(N-methylacetimidoyl)-1-naphthol (MAN) reveals composite absorption and emission spectra from 298 to 193 K in hexane. The ground electronic state (So) absorption can be assigned to the sum of three molecular structures: the OH normal tautomer, and two NH proton transfer tautomers. The NH-structures are the most stable ones in equilibrium with the OH tautomer for the S0 state. On photoexcitation of the OH tautomer the excited state intramolecular proton transfer is undergone, and the corresponding NH emission is monitored at 470 nm. On photoexcitation of the NH tautomers the previous emission is monitored in addition to another emission at 600 nm, which is ascribed to intramolecular hydrogen-bonded (IHB) nonplanar NH structures generated from the IHB planar NH tautomers. A Jabłoński diagram is introduced which gathers all the experimental evidence as well as the theoretical calculations executed at the DFT-B3LYP and TD-DFT levels. The MAN molecule is compared with other analogs such as 1-hydroxy-2-acetonaphthone (HAN), 2-(1΄-hydroxy-2΄-naphthyl)benzimidazole and methyl 1-hydroxy-2-naphthoate to validate the theoretical calculations. Photoexcitation of MAN generates two emission bands at longer wavelengths than that of the emission band of HAN. The MAN molecule exhibits a great photostability in hydrocarbon solution which depends on the photophysics of the NH tautomers (keto forms).

Thumbnail image of graphical abstract

The steady-state spectroscopy of 2-(N-methylacetimidoyl)-1-naphthol reveals composite absorption and emission spectra from 298 to 193 K in hexane. The S0 state absorption can be assigned to the sum of three molecular structures in chemical equilibrium: the OH normal tautomer and two NH proton transfer tautomers. On photoexcitation of the OH tautomer the excited state intramolecular proton transfer is undergone, and the corresponding NH emission is monitored at 470 nm. On photoexcitation of the NH tautomers the previous emission is monitored in addition to another emission at 600 nm, which is ascribed to intramolecular hydrogen-bonded (IHB) nonplanar NH tautomers generated from the IHB planar NH tautomers.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:28 am CET

Nanometal Surface Energy Transfer Optical Ruler for Measuring a Human Telomere Structure

Abstract

Nanometal surface energy transfer (NSET) techniques on gold nanoparticles (AuNPs) have become an essential tool in molecular biophysics to identify structural details at long-range donor-acceptor distances. The NSET mechanism is well described, but it has been suggested that the use of large AuNPs in NSET may manipulate natural biomolecular function. If, in fact, such nonspecific interactions with the AuNP surface can be quantified or contained, then NSET may offer more potential in tracking biomolecular folding than the most comprehensive methods in conformer determination (X-ray crystallography, NMR, EPR). Here, we describe an NSET ruler capable of tracking Hybrid-2 telomere quadruplex folding and we demonstrate that nucleic acid appendage to AuNPs up to 10 nm in diameter does not manipulate biomolecular function. The quadruplex folding of Hybrid-2 sequences was tracked by monitoring the emission of a DY680 dye on selected basepairs in the telomere sequence when appended to the surface of AuNPs (5–10 nm). Emission-derived distances extracted from NSET theory correlate well to reported NMR structures of the hybrid quadruplex. Moreover, NSET theory calculates identical donor-acceptor distal points between DY680 and all sizes of AuNPs, indicating that the AuNP tether is not dominant or disruptive towards nucleic acid folding.

Thumbnail image of graphical abstract

Through the use of optical quenching of a molecular dye (DY680) by a gold nanoparticle appended to DNA, the conformation of the Hybrid-2 conformer in telomeric DNA sequence was measured. The results clearly demonstrate the versatility of nanometal surface energy transfer (NSET) molecular rulers for measuring biopolymer structures, allowing mapping of the structure and no evidence of nonspecific interactions between the gold and DNA sequence which would lead to perturbation of the folding landscape.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:27 am CET

Biomodulation of Inflammatory Cytokines Related to Oral Mucositis by Low-Level Laser Therapy

Abstract

This study evaluated the effects of LLLT on the expression of inflammatory cytokines related to the development of oral mucositis by gingival fibroblasts. Primary gingival fibroblasts were seeded on 24-well plates (105 cells/well) for 24 h. Fresh serum-free culture medium (DMEM) was then added, and cells were placed in contact with LPS (Escherichia coli, 1 μg mL−1), followed by LLLT irradiation (LaserTABLE—InGaAsP diode prototype—780 nm, 25 mW) delivering 0, 0.5, 1.5 or 3 J cm². Cells without contact with LPS were also irradiated with the same energy densities. Gene expression of TNF-α, IL-1β, IL-6 and IL-8 was evaluated by Real-Time PCR, and protein synthesis of these cytokines was determined by enzyme-linked immunosorbent (ELISA) assay. Data were statistically analyzed by the Kruskal–Wallis test, complemented by the Mann–Whitney test (< 0.05). LPS treatment increased the gene expression and protein synthesis of TNF-α, IL-6 and IL-8, while the expression of IL-1β was not affected. For LPS-treated groups, LLLT promoted significant decreases in the expression of TNF-α, IL-6, and IL-8 at 1.5 J cm−2 and 3 J cm−2. These results demonstrate that LLLT promoted a beneficial biomodulatory effect on the expression of inflammatory cytokines related to oral mucositis by human gingival fibroblasts.

Thumbnail image of graphical abstract

This study evaluated the effects of low level laser therapy (LLLT) on the expression of inflammatory cytokines involved in the development and severity of oral mucositis. Human gingival fibroblasts treated with LPS (Escherichia coli, 1 μg mL−1) were subjected to LLLT irradiation (LaserTABLE—InGaAsP diode prototype—780 nm, 25 mW) delivering 0, 0.5, 1.5, or 3 J cm². LLLT promoted significant decreases in the expression of TNF-α, IL-6 and IL-8 at 1.5 J cm−2 and 3 J cm−2. These results demonstrate that LLLT promoted a beneficial biomodulatory effect on the expression of inflammatory cytokines related to oral mucositis by human gingival fibroblasts.

Quelle: Photochemistry and Photobiology | 28 Mar 2015 | 9:24 am CET

Continuous process of the vacuum ultraviolet- (VUV-) photochemical oxidation of thiophene in the gas phase

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00476K, Paper
Haingo L. Andriampanarivo, Martin Kohler, Juan Lopez Gejo, Thomas Betzwieser, Benny C. Y. Poon, Po Lock Yue, Solofonirina D. Ravelomanantsoa, Andre M. Braun
Based on kinetic data and intermediate products of oxidation, reaction pathways of the oxidative degradation of gaseous thiophene are discussed.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 26 Mar 2015 | 1:00 am CET

Photochemical activation of drugs for the treatment of therapy-resistant cancers

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00029G, Perspective
Anette Weyergang, Maria E. B. Berstad, Bente Bull-Hansen, Cathrine E. Olsen, Pal K. Selbo, Kristian Berg
Resistance to chemotherapy, molecular targeted therapy as well as radiation therapy is a major obstacle for cancer treatment.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 25 Mar 2015 | 1:00 am CET

EPR spin trapping evidence of radical intermediates in the photo-reduction of bicarbonate/CO2 in TiO2 aqueous suspensions

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00467A, Paper
Alessandra Molinari, Luca Samiolo, Rossano Amadelli
Storage of CO2 as carbonates is a strategy for its reductive activation. Carbonates are reduced at pH 5.5-7.5 with photoexcited TiO2. EPR is convenient for detecting reaction intermediates.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 25 Mar 2015 | 1:00 am CET

Spatial distribution and temporal evolution of DRONPA-fused SNAP25 clusters in adrenal chromaffin cells

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00423J, Paper
Open Access Open Access
Yasuko Antoku, Peter Dedecker, Paulo S. Pinheiro, Tom Vosch, Jakob Balslev Sorensen
Sub-diffraction imaging of DRONPA-fused SNAP-25 in adrenal chromaffin cells allows tracking protein cluster dynamics over relative long time (20 min) and reveal that clusters have rich dynamics going from staying constant to disappearing and reappearing within minutes.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Mar 2015 | 1:00 am CET

The role of cytoskeleton and adhesion proteins in the resistance to photodynamic therapy. Possible therapeutic interventions

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00445K, Perspective
Gabriela Di Venosa, Christian Perotti, Alcira Batlle, Adriana Casas
A review on the changes induced by photodynamic therapy on cytoskeleton and molecules involved in cell adhesion. Possible interactions of PDT with molecular targeted therapies.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Mar 2015 | 1:00 am CET

The contribution of mycosporine-like amino acids, chromophoric dissolved organic matter and particles to the UV protection of sea-ice organisms in the Baltic Sea

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00342J, Paper
Jonna Piiparinen, Sara Enberg, Janne-Markus Rintala, Ruben Sommaruga, Markus Majaneva, Riitta Autio, Anssi V. Vahatalo
Variety of mycosporine-like amino acids, chromophoric dissolved organic matter and deposited atmospheric particles provide UV-protection for sea-ice organisms.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 24 Mar 2015 | 1:00 am CET

Survey of UV Emissions from Sunbeds in the UK

Abstract

Increased use of indoor tanning for cosmetic purposes has led to concerns for its impact on the risk of cutaneous cancers. The effects on UVR on skin depend on radiant dose, i.e. combination of irradiance and exposure duration. While a number of studies surveyed accessible emission from sunbeds, majority did not include the information on doses received during tanning sessions. Spectral irradiance of 195 sunbeds in five areas of the United Kingdom was measured in order to assess the radiant doses for comparison with the SED. Erythema weighted irradiance of more than 85% of all tested solaria exceeded 0.3 W m−2, consistent with the findings of other studies. However, evaluation of radiant doses showed no evidence of increasing exposure per session in the United Kingdom in the last decade despite the increasing sunbed emission levels. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under-18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use, and information should reduce the risk of detrimental impact of sunbed use on public health.

Thumbnail image of graphical abstract

Spectral irradiance of 195 sunbeds in five areas of the United Kingdom was measured in order to assess the radiant doses as increased use of indoor tanning has led to concerns for its impact on the risk of cutaneous cancers. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under-18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use and information should reduce the risk of detrimental impact of sunbed use on public health.

Quelle: Photochemistry and Photobiology | 23 Mar 2015 | 9:53 am CET

Photocatalytic Activity of LaSr2AlO5:Eu Ceramic Powders

Abstract

The photocatalytic activity, of undoped and Europium-doped LaSr2AlO5 powders, has been investigated by degrading methylene blue dye in water solutions. Those powders were fabricated by a combustion method and an annealing treatment in air. All samples showed a tetragonal single phase according to by X-ray diffraction measurements (XRD). Scanning electron microscopy (SEM) revealed irregular semi-oval grains with sizes in the range of 3.5–4.27 μm. Photoluminescence spectrum showed sharp emission peaks at 588 nm and at 617 nm which are associated with 7F1,7F2[RIGHTWARDS ARROW] 5D0 Eu3+ ion forbidden transitions, respectively, under UV light excitation of 322 nm. The methylene blue (MB) degradation under UV light (254 nm) was studied by monitoring changes in the absorbance peak of MB at 665 nm. Finally, LaSr2AlO5:Eu powders were used three times and the efficiency for the degradation of MB decreased from 100 to 61% after the third cycle of use.

Thumbnail image of graphical abstract

Europium-doped LaSr2AlO5 (LSA:Eu) has been investigated as photocatalyst for methylene blue degradation in water solutions under UV light. The photograph shows a sequence of the solutions taken each 10 min in the third cycle of use, and achieving total degradation after 360 min of UV irradiation.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:28 am CET

Fluorescence Properties of Diphenylthiazolo[4,5-b]pyrazines Tuned by Donor-Acceptor Substituent Effects

Abstract

Fluorescence properties of 2,6- and 2,5-diphenylthiazolo[4,5-b]pyrazine (TPy) derivatives having an electron-donating substituent (methoxy and dimethylamino) on the 6- and 5-phenyl groups were studied. It was found that 2,6-diphenyl derivatives fluoresce more efficiently than 2,5-diphenyl derivatives. Furthermore, a 2,6-diphenyl derivative having an additional cyano group on the 2-phenyl ring was an excellent fluorophore showing a wide solvatochromism with great fluorescence yields. Based on the obtained spectroscopic data and mechanistic explanations concerning the substituent effects on the fluorescence properties, useful information on designing new TPy fluorophores is provided.

Thumbnail image of graphical abstract

Fluorescence properties of 2,6- and 2,5-diphenylthiazolo[4,5-b]pyrazines having an electron-donating substituent (methoxy and dimethylamino) on the 6- and 5-phenyl groups were studied. Furthermore, 2,6-diphenyl derivatives having an additional cyano group on the 2-phenyl ring were developed, to give an excellent fluorophore.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:09 am CET

Salvianolic Acid B Protects Normal Human Dermal Fibroblasts Against Ultraviolet B Irradiation-Induced Photoaging Through Mitogen-Activated Protein Kinase and Activator Protein-1 Pathways

Abstract

Exposure to ultraviolet (UV) light causes increased matrix metalloproteinase (MMP) activity and decreased collagen synthesis, leading to skin photoaging. Salvianolic acid B (SAB), a polyphenol, was extracted and purified from salvia miltiorrhiza. We assessed effects of SAB on UVB-induced photoaging and investigated its molecular mechanism of action in UVB-irradiated normal human dermal fibroblasts. Our results show that SAB significantly inhibited the UVB-induced expression of metalloproteinases-1 (MMP-1) and interleukin-6 (IL-6) while promoting the production of type I procollagen and transforming growth factor β1 (TGF-β1). Moreover, treatment with SAB in the range of 1–100 μg/mL significantly inhibited UVB-induced extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 phosphorylation, which resulted in decreasing UVB-induced phosphorylation of c-Fos and c-Jun. These results indicate that SAB downregulates UV-induced MMP-1 expression by inhibiting Mitogen-activated protein kinase (MAPK) signaling pathways and activator protein-1 (AP-1) activation. Our results suggest a potential use for SAB in skin photoprotection.

Thumbnail image of graphical abstract

UV causes increased matrix metalloproteinase (MMP) activity and decreased collagen synthesis, leading to skin photoaging. We found that salvianolic acid B (SAB) significantly inhibited the UVB-induced expression of metalloproteinases-1 (MMP-1) while promoting the production of transforming growth factor β1 (TGF-β1). Moreover, SAB strongly inhibited UVB-induced extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 phosphorylation, which resulted in decreasing UVB-induced phosphorylation of c-Fos and c-Jun. These results indicate that SAB down-regulates UV-induced MMP-1 expression by inhibiting mitogen-activated protein kinase (MAPK) signaling pathways and activator protein-1 (AP-1) activation.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:09 am CET

Luciferin-Regenerating Enzyme Mediates Firefly Luciferase Activation Through Direct Effects of D-Cysteine on Luciferase Structure and Activity

Abstract

Luciferin-regenerating enzyme (LRE) contributes to in vitro recycling of D-luciferin. In this study, reinvestigation of the luciferase-based LRE assay is reported. Here, using quick change site-directed mutagenesis seven T-LRE (Lampyris turkestanicusLRE) mutants were constructed and the most functional mutant of T-LRE (T69R) was selected for this research and the effects of D- and L-cysteine on T69R T-LRE-luciferase-coupled assay are examined. Our results demonstrate that bioluminescent signal of T69R T-LRE-luciferase-coupled assay increases and then reach equilibrium state in the presence of 5 mm D-cysteine. In addition, results reveal that 5 mm D- and L-cysteine in the absence of T69R T-LRE cause a significant increase in bioluminescence intensity of luciferase over a long time as well as decrease in decay rate. Based on activity measurements, far-UV CD analysis, ANS fluorescence and DLS (Dynamic light scattering) results, D-cysteine increases the activity of luciferase due to weak redox potential, antiaggregatory effects, induction of changes in conformational structure and kinetics properties. In conclusion, in spite of previous reports on the effect of LRE on luciferase bioluminescent intensity, the majority of increase in luciferase light output and time-course originate from the direct effects of D-cysteine on structure and activity of firefly luciferase.

Thumbnail image of graphical abstract

The addition of D-cysteine in the absence of T69R T-LRE (closed circle) to luciferase reaction increased the bioluminescent level over time in comparison with a luciferase reaction containing D-cysteine in the presence of T69R T-LRE (closed diamond) and control (solid line). Thus, even in the presence of LRE the majority of this increase occurs from the direct effects of D-cysteine.

Quelle: Photochemistry and Photobiology | 18 Mar 2015 | 7:07 am CET

Enhancement of antiproliferative activity by phototautomerization of anthrylphenols

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C5PP00099H, Paper
Marijeta Kralj, Lidija Uzelac, Yu-Hsuan Wang, Peter Wan, Martina Tireli, Kata Mlinaric-Majerski, Ivo Piantanida, Nikola Basaric
9-(2-Hydroxyphenyl)anthracene (1) moderately inhibited the proliferation of human cancer cells, but irradiation considerably enhanced the effect due to the formation of quinone methide. The effect is not only due to the damage of DNA, but also due to the impact on the cellular proteins.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 18 Mar 2015 | 1:00 am CET

Variability of Solar Radiation and CDOM in Surface Coastal Waters of the Northwestern Mediterranean Sea

Abstract

Atmospheric and in-water solar radiation, including UVR-B, UVR-A and PAR, as well as chromophoric dissolved organic matter absorption [aCDOM(λ)] in surface waters were monthly measured from November 2007 to December 2008 at a coastal station in the Northwestern Mediterranean Sea (Bay of Marseilles, France). Our results showed that the UVR-B/UVR–A ratio followed the same trend in the atmosphere and at 2 m depth in the water (P < 0.0001) with an increase (eight-fold higher) during summer. The low diffuse attenuation coefficients for downward irradiance [Kd(λ)] of UVR-B, UVR-A and PAR indicated that the waters were highly transparent throughout the year. The relationships between aCDOM(λ) and Kd(λ) in this oligotrophic system suggested that CDOM contributed to UVR attenuation in the UVA domain, but also played a significant role in PAR attenuation. Mean UV doses received in the mixed layer depth were higher by a factor 1.4–33 relative to doses received at fixed depths (5 and 10 m) in summer (stratified period), while the inverse pattern was found in winter (mixing period). This shows the importance of taking into account the vertical mixing in the evaluation of UVR effects on marine organisms.

Thumbnail image of graphical abstract

The wavelengths 305 and 380 nm have been chosen as biologically effective wavelengths for the induction of DNA damages (CPDs) and photorepairs (PERs) respectively. The ratio of the mean doses received within the mixed layer at 305 and 380 nm [Q in % = H(m,305)]/H(m,380) × 100] along with the mixed layer depth (Zm) are presented. Q ratio can be considered as an indicator of changes in the balance between DNA damages (CPDs) and repairs (PERs). Clearly, Q increased with the stratification of the water column.

Quelle: Photochemistry and Photobiology | 16 Mar 2015 | 6:18 am CET

Actual Isothermal Effects of Water-Filtered Infrared A-Irradiation

Abstract

In this study, the athermal effects of water-filtered infrared A (wIRA)-irradiation (780–1400 nm) on human dermal fibroblasts were investigated. For this purpose, cells were exposed to wIRA-irradiation (178 mW cm−2 for 1 h), while a sophisticated experimental setup prevented warming of the samples exceeding 0.1°C. The investigated parameters were the formation of reactive oxygen species (ROS), mitochondrial membrane potential and superoxide release, protein oxidation, proliferation rate, as well as intracellular Ca2+-release in single cells, most of them quantified via fluorescence microscopy and fluorimetric techniques. The existence of actual athermal wIRA-effects is still intensively discussed, since their detection requires a careful experimental setup and both efficient and powerful temperature regulation of the exposed samples. Here, we can definitively show that some of the supposed athermal wIRA-effects may be rather artifacts, since wIRA did not reveal any impact on the above mentioned parameters—as long as the temperature of the exposed cells was carefully maintained. Though, we were able to identify an athermal DNA-protective wIRA-effect, since the induced DNA damage (quantified via 8-Oxo-G-formation) was significantly decreased after a subsequent UVB-exposure. These results suggest that many of the supposed athermal wIRA-effects can be induced by pure warming of the samples, independent from any wIRA-irradiation.

Thumbnail image of graphical abstract

In this work, we exposed human dermal fibroblasts to water-filtered infrared A (wIRA)-irradiation under isothermal conditions in order to investigate changes in the parameters intracellular free calcium, mitochondrial membrane potential and radical production, DNA and protein oxidation, cell proliferation and protection against UVB.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:30 am CET

Human Hair as a Natural Sun Protection Agent: A Quantitative Study

Abstract

The rising incidence of skin cancers attributable to excessive sun exposure has become a major health concern worldwide. While numerous studies have analyzed the sun protective effect of sunscreens, clothing and antioxidants, none to date have measured the photoprotective effect of hair, despite clinical evidence that individuals with balding or thinning hair are at greater risk of skin lesions that can progress to cancer, hence the recommendation to use hats or umbrellas. We analyzed the level of protection offered by hair according to hair density, thickness and color using the spectral transmittance and corrected for relative erythema effectiveness. Our results show that hair provides a barrier against both UVB and UVA radiation which is significantly increased with respect to the hair density, thickness and the presence of melanins. This is the first study to quantify sun protection factor offered by hair, namely hair ultraviolet protection factor (HUPF). We believe that hair should be recognized as an important natural sun barrier in the prevention of UV-induced skin cancers.

Thumbnail image of graphical abstract

Hair provides a barrier against both UVB and UVA radiation which is significantly increased with respect to the hair density (A), thickness (B) and the presence of melanins (hair color) (C). This is the first study to quantify sun protection factor offered by hair, namely hair ultraviolet protection factor (HUPF). Hair should be recognized as an important natural sun barrier in the prevention of UV-induced skin cancers.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:30 am CET

Electron Spin Exchange in Linked Phenothiazine–Viologen Charge Transfer Complexes Incorporated in “Through-Ring” (Rotaxane) α-Cyclodextrins

Abstract

A series of covalently bound phenothiazine (PHZ) donor and methylviologen (V) acceptor compounds with polymethylene chain spacers (C8, C10, C12) were incorporated in a “through-ring” (rotaxane) fashion to α-cyclodextrin (α-CD) hosts such that the alkyl chains were fully extended, with the donor and acceptor on opposite sides of the α-CD cylinder. Photoexcitation of the PHZ unit induces electron transfer from the PHZ first excited triplet state to the V moiety, forming a biradicaloid charge-separated state. Time-resolved electron paramagnetic resonance (TREPR) spectroscopy at the X-band and Q-band microwave frequencies was used to investigate the spin exchange interaction, J, in these biradicaloids. Simulation of the spectra using a “static” model for spin-correlated radical pairs allows extraction of the J values, which are negative in sign and have absolute values range from 2 to 1000 Gauss. Comparison of the PHZnV (n = 8, 10, 12) spectra to those obtained using phenyl ether spacers indicates that π-bonds may assist the electronic coupling. The results are discussed in terms of through-bond vs through-space electronic coupling mechanisms.

Thumbnail image of graphical abstract

Photoexcitation of covalently bound phenothiazine donors with methylviologen acceptors separated by C8, C10 and C12 alkane chain spacers incorporated in a “through-ring” (rotaxane) fashion to α-cyclodextrin hosts leads to biradicaloid charge-separated states that are studied by time-resolved electron paramagnetic resonance spectroscopy at the X-band and Q-band microwave frequencies. Computer simulation of the spectra using a “static” model for spin-correlated radical pairs allows extraction of the spin exchange interactions, which range from –2 to –1000 Gauss. The results are discussed in terms of through-bond vs through-space electronic coupling mechanisms as a function of donor–acceptor distance.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:17 am CET

Histopathological Analysis of UVB and IR Interaction in Rat Skin

Abstract

To determine the chronic skin effects caused by the interaction of infrared and ultraviolet B radiations, male Rattus norvegicus (Wistar) (2 months old) were exposed for 15 days to infrared radiation (600–1500 nm, with a peak at 1000 nm, n = 12) for 30 min (1080 J cm−2) (IRo); to ultraviolet B radiation (peak emission at 313 nm, n = 9) for 90 min (55.08 J cm−2) (UVB); to infrared radiation followed after 90 min by ultraviolet B (n = 6) (IRUVB) and to ultraviolet B followed after 90 min by infrared radiation (n = 9) (UVBIR). Skin samples were collected and histopathological analysis showed the presence of acanthosis, parakeratotic and orthokeratotic hyperkeratosis, intraepidermal pustules, keratin pearls, detachment of epidermis, collagen necrosis, inflammatory infiltrate, vasodilation, basal cell vacuolization and superficial dermis degeneration both in UVB and UVBIR treatments. IRUVB animals showed the same characteristics as above except for parakeratotic hyperkeratosis, keratin pearls and superficial dermis degeneration. To conclude, infrared radiation exposure after ultraviolet B irradiation increases skin damage without protecting the tissue, while infrared radiation exposure before ultraviolet B irradiation showed a protective effect against ultraviolet skin damage.

Thumbnail image of graphical abstract

Chronic IR exposure before UVB irradiation can reduce some of the histopathological alterations caused by UVB while chronic IR exposure after UVB irradiation can enhance most of the histopathological features caused by UVB skin damage.

Quelle: Photochemistry and Photobiology | 12 Mar 2015 | 6:14 am CET

Electronic and Vibrational Dynamics of Hollow Au Nanocages Embedded in Cu2O Shells

Abstract

We have synthesized hollow Au nanocages embedded within thick porous shells of cuprous oxide (Cu2O). The shell causes a significant redshift of the localized surface plasmon resonance of Au into the near-IR. Electron–phonon coupling in the Au nanocage is 3–6 times faster in the core–shell structure due to the higher thermal conductivity of Cu2O compared to water. Coherent phonon oscillations within the Au lattice are characterized by a breathing mode of the entire structure for both bare and core–shell nanocages, an assignment made through the use of structural mechanics simulations. The experimental frequencies are obtained through simulations by selectively applying a force to the shell of the core–shell structure. We interpret this as rapid thermal expansion of the gold leading to a mechanical force that acts on the shell.

Thumbnail image of graphical abstract

Femtosecond optical excitation of the localized surface plasmon resonance of Au–Cu2O core-shell nanocages creates hot electrons which transfer energy to the Au and Cu2O lattices on picosecond timescales, leading to coherent vibrational motion. Structural mechanics simulations reproduce the dominant lattice vibrational frequency by treating the rapid thermal expansion of the Au nanocage as a force that acts on the Cu2O shell.

Quelle: Photochemistry and Photobiology | 10 Mar 2015 | 7:32 am CET

The role of photodynamic therapy in overcoming cancer drug resistance

Photochem. Photobiol. Sci., 2015, Advance Article
DOI: 10.1039/C4PP00495G, Perspective
Bryan Q. Spring, Imran Rizvi, Nan Xu, Tayyaba Hasan
This perspective highlights unique mechanisms of photodynamic therapy (PDT) that can be utilized to overcome classical drug resistance and re-sensitize resistant cancer cells for standard therapies.
To cite this article before page numbers are assigned, use the DOI form of citation above.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 10 Mar 2015 | 1:00 am CET

A Tribute to the Extraordinary Career (1964-present) of James Edward Cleaver

Thumbnail image of graphical abstract

Quelle: Photochemistry and Photobiology | 6 Mar 2015 | 7:00 am CET

A bright Quantum of Time in the Cleaver Laboratory; a Tribute and Retrospective

Quelle: Photochemistry and Photobiology | 6 Mar 2015 | 6:59 am CET

Editorial

Quelle: Photochemistry and Photobiology | 6 Mar 2015 | 6:59 am CET

Interfacial Engineering of CdO–CdSe 3D Microarchitectures with in situ Photopolymerized PEDOT for an Enhanced Photovoltaic Performance

Abstract

In the present work, porous 3D CdO-microstructured electrode obtained by pyrolysis of 3D CdCO3 microstructures is self-sensitized with CdSe using an ion exchange reaction. After sensitization, an interfacial treatment of the CdO–CdSe interface is performed by depositing a thin film of PEDOT using a photoinduce polymerization route. The microstructured electrode before and after interfacial treatment is characterized using field-emission scanning microscope, energy dispersive X-ray analyzer, contact angle measurement, UV–Visible absorption spectrophotometer and X-ray photoelectron spectrometer. After constructing a liquid junction solar cell with a Pt counter electrode, the photovoltaic performance and interfacial charge transfer kinetics across the CdO–CdSe interface before and after PEDOT treatment are investigated. The results exhibit an improved interfacial charge-transfer resistance after the PEDOT treatment, which leads to enhance the short-circuit current by 15.81% and the power conversion efficiency by 19.82%.

Thumbnail image of graphical abstract

Interfacial engineering of 3D CdO–CdSe-microstructured film by deposition of PEDOT accelerates the interfacial electron transfer rate, and thereby the interfacial electron collection efficiency is enhanced. Thus, the short-circuit current of the device is enhanced significantly.

Quelle: Photochemistry and Photobiology | 28 Feb 2015 | 8:27 am CET

Decontamination Efficiency of a DBD Lamp Containing an UV–C Emitting Phosphor

Abstract

Among different physical and chemical agents, the UV radiation appears to be an important route for inactivation of resistant microorganisms. The present study introduces a new mercury-free Dielectric Barrier Discharge (DBD) flat lamp, where the biocide action comes from the UV emission produced by rare-earth phosphor obtained by spray pyrolysis, following plasma excitation. In this study, the emission intensity of the prototype lamp is tuned by controlling gas pressure and electrical power, 500 mbar and 15 W, corresponding to optimal conditions. In order to characterize the prototype lamp, the energetic output, temperature increase following lamp ignition and ozone production of the source were measured. The bactericidal experiments carried out showed excellent results for several gram-positive and gram-negative bacterial strains, thus demonstrating the high decontamination efficiency of the DBD flat lamp. Finally, the study of the external morphology of the microorganisms after the exposure to the UV emission suggested that other mechanisms than the bacterial DNA damage could be involved in the inactivation process.

Thumbnail image of graphical abstract

An innovative mercury-free Dielectric Barrier Discharge (DBD) flat lamp has been developed to obtain large spectrum UV-C radiation. The UV-C radiation is produced by a pyrophosphate phosphor doped with Pr3+ (α-Ca2P2O7: Pr2%Na2%) internal coating excited by the 172 nm emission of a Ne-Xe plasma. This work investigates the influence of the plasma parameters on the newly developed UV source energy efficiency and its bactericidal efficiency.

Quelle: Photochemistry and Photobiology | 23 Feb 2015 | 5:36 am CET

Evaluation of Photoprotective Potential and Percutaneous Penetration by Photoacoustic Spectroscopy of the Schinus terebinthifolius Raddi Extract

Abstract

Schinus terebinthifolius is a plant rich in phenolic compounds, which have antioxidant properties and can provide new opportunities for treatment and prevention of diseases mediated by ultraviolet radiation like photoaging and skin cancer. The aim of this study was to evaluate the photoprotective potential and ex vivo percutaneous penetration of the crude extract of Schinus terebinthifolius leaves. The extract was tested for antioxidant activity using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) method and β-carotene bleaching test. The sun protection factor was also evaluated. The ex vivo skin permeation of the emulsion and gel formulations were assayed. Fractionation of the extract resulted in gallic acid, ethyl gallate and a mixture of flavonoids, suggesting derivatives of quercetin and myricetin. The phenolic content of the extract was 384.64 ± 2.60 mg GAE g−1 extract. The antioxidant activity was superior to butylated hydroxytoluene, in DPPH method, and ascorbic acid and rutin, in β-carotene bleaching assay. The extract showed UV absorption with photoprotector potential in the UVB region. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and topical application of the formulations caused no histological changes in the rats' skin. These results suggest that the crude extract of Schinus terebinthifolius leaves may be a promising natural sunscreen product.

Thumbnail image of graphical abstract

Plant extracts can be incorporated in photoprotective formulations. The crude extract and the fraction containing gallic acid, ethyl gallate and a mixture of flavonoids were obtained from Schinus terebinthifolius leaves. Emulsion and gel formulations containing the crude extract were prepared to evaluate the permeation and the histology of the skin after topical application of the formulations. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and related to the permeation of these formulations. No histopathological changes were detected.

Quelle: Photochemistry and Photobiology | 18 Feb 2015 | 12:57 pm CET

Hiporfin-Mediated Photodynamic Therapy in Preclinical Treatment of Osteosarcoma

Abstract

This study was carried out to investigate the anti-tumor effect and mechanism of hiporfin-mediated photodynamic therapy (hiporfin-PDT) in osteosarcoma. We found that hiporfin accumulated mainly in the cytoplasm of osteosarcoma cells in a time and concentration-dependent manner. Hiporfin-PDT inhibited the proliferation, induced apoptosis and produced cell cycle arrest at G2M in osteosarcoma cell lines. Hiporfin-PDT increased the expression of cleaved-caspase-3, cleaved PARP-1, Bax and RIP1 while it decreased the expression of Bcl-2; in addition, low concentration of hiporfin increased LC3 conversion. Furthermore, cell death caused by hiporfin-PDT could be rescued by Nec-1 but not by Z-VAD-FMK. Production of reactive oxygen species was increased after hiporfin-PDT. In vivo studies showed a significant decrease in tumor volume and weight after hiporfin-PDT in all three tumor mouse models investigated (subcutaneous and orthotopic). Histological analysis showed widespread cell apoptosis and necrosis after treatment. Immunohistochemistry also showed upregulation of cleaved-caspase-3 and downregulation of Bcl-2 after hiporfin-PDT. These results indicate that hiporfin-PDT exhibits a killing effect in osteosarcoma both in vitro and in vivo, which is associated with apoptosis and necroptosis, while autophagy plays a protective role. All these findings shed light on a potential future clinical use for hiporfin in the treatment of osteosarcoma.

Thumbnail image of graphical abstract

Hiporfin is one kind of photosensitizer that has been approved by Chinese SFDA. In this study, hiporfin was used to see its photodynamic activity in osteosarcoma. After illumination by 630 nm laser, hiporfin killed osteosarcoma cells by increased ROS level and through apoptosis and necroptosis pathways. In vivo study also showed potent tumor eradication. All these provided evidences for the clinical trial of hiporfin on osteosarcoma.

Quelle: Photochemistry and Photobiology | 16 Feb 2015 | 6:38 am CET

Enhancing the output current of a CdTe solar cell via a CN-free hydrocarbon luminescent down-shifting fluorophore with intramolecular energy transfer and restricted internal rotation characteristics

Photochem. Photobiol. Sci., 2015, 14,833-841
DOI: 10.1039/C4PP00480A, Paper
Yilin Li, Joseph Olsen, Wen-Ji Dong
A novel CN-free hydrocarbon as a luminescent down-shifting fluorophore that enhances the output short circuit current density of a CdTe solar cell by as high as 3.30 +/- 0.31%.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 13 Feb 2015 | 1:00 am CET

One-Pot Synthesis of Cu2O/ZnO Nanoparticles at Present of Folic Acid to Improve UV-Protective Effect of Cotton Fabrics

Abstract

In this study, the effect of using folic acid on the in situ synthesis process of nanostructures has been investigated. Folic acid, as a biotemplate for synthesis of Cu2O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric and avoid agglomeration of the particles. Scanning electron microscopy images revealed that using folic acid caused the formation of particles with smaller sizes on the cotton fabric and X-ray diffraction confirmed the same crystalline pattern of nanoparticles in comparison with the previous synthesis process. The effect of using this biotemplate on different properties of treated fabrics including UV-protection effect, hydrophilicity, crease recovery angle, softness, thickness and mechanical properties has been evaluated. The folic acid had a great influence on UV-protection effect, in synthesis procedure, decreasing the droplet absorption time, bending length and improving the wrinkle resistance and mechanical properties. Interestingly, the higher tensile strength of the treated cotton fabrics proved the incorporation of nanoparticles into the cotton fibers. An in situ, green and rapid method can be provided by using folic acid for the synthesis of the nanostructures with controlled size.

Thumbnail image of graphical abstract

In this work, zinc chloride and copper sulfate have been used as precursors and Cu2O/ZnO nanoparticles have been synthesized in aqueous/alkali media at the presence of cotton fabrics and folic acid. Folic acid, as a biotemplate for synthesis of Cu2O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric. Cotton fabric was used as a soft template to control the synthesis of desirable nanostructures with specific size and morphology.

Quelle: Photochemistry and Photobiology | 10 Feb 2015 | 12:23 pm CET

Interphotoreceptor Retinoid-Binding Protein Protects Retinoids from Photodegradation

Abstract

Retinol degrades rapidly in light into a variety of photoproducts. It is remarkable that visual cycle retinoids can evade photodegradation as they are exchanged between the photoreceptors, retinal pigment epithelium and Müller glia. Within the interphotoreceptor matrix, all-trans retinol, 11-cis retinol and retinal are bound by interphotoreceptor retinoid-binding protein (IRBP). Apart from its role in retinoid trafficking and targeting, could IRBP have a photoprotective function? HPLC was used to evaluate the ability of IRBP to protect all-trans and 11-cis retinols from photodegradation when exposed to incandescent light (0 to 8842 μW cm−2); time periods of 0–60 min, and bIRBP: retinol molar ratios of 1:1 to 1:5. bIRBP afforded a significant prevention of both all-trans and 11-cis retinol to rapid photodegradation. The effect was significant over the entire light intensity range tested, and extended to the bIRBP: retinol ratio 1:5. In view of the continual exposure of the retina to light, and the high oxidative stress in the outer retina, our results suggest IRBP may have an important protective role in the visual cycle by reducing photodegradation of all-trans and 11-cis retinols. This role of IRBP is particularly relevant in the high flux conditions of the cone visual cycle.

Thumbnail image of graphical abstract

Visual cycle retinoids are highly susceptible to UV-light-mediated photodegradation. However, interphotoreceptor retinoid-binding protein (IRBP), the most abundant protein component of the extracellular matrix surrounding the photoreceptors, affords significant photoprotection. This reveals a novel and important role of IRBP in protecting the retina from toxic retinoid photodegradation products.

Quelle: Photochemistry and Photobiology | 10 Feb 2015 | 12:18 pm CET

Development of Effective Skin Cancer Treatment and Prevention in Xeroderma Pigmentosum

Abstract

Xeroderma pigmentosum (XP) is a rare, recessively transmitted genetic disease characterized by increasingly marked dyspigmentation and xerosis (dryness) of sun-exposed tissues, especially skin. Skin cancers characteristically develop in sun-exposed sites at very much earlier ages than in the general population; these are often multiple and hundreds or even thousands may develop. Eight complementation groups have been identified. Seven groups, XP-A…G, are associated with defective genes encoding proteins involved in the nucleotide excision DNA repair (NER) pathway that recognizes and excises mutagenic changes induced in DNA by sunlight; the eighth group, XP-V, is associated with defective translesion synthesis (TLS) bypassing such alterations. The dyspigmentation, xerosis and eventually carcinogenesis in XP patients appear to be due to their cells’ failure to respond properly to these mutagenic DNA alterations, leading to mutations in skin cells. A subset of cases, especially those in some complementation groups, may develop neurological degeneration, which may be severe. However, in most XP patients, in the past the multiple skin cancers have led to death at an early age due to either metastases or sepsis. Using either topical 5-fluorouracil or imiquimod, we have developed a protocol that effectively prevents most skin cancer development in XP patients.

Thumbnail image of graphical abstract

Xeroderma pigmentosum is a genetically heterogeneous recessively inherited disease associated with defective cellular responses to damage induced in DNA by sunlight. Most patients develop numerous skin cancers in sun-exposed sites. Hundreds, or even thousands of such tumors may develop, and metastatic spread of these lesions is the leading cause of death, often at an early age. We have now developed an effective treatment (Figure), administered before most clinically manifest tumors arise, which, combined with sun protection, prevents development of almost all skin cancers in patients with xeroderma pigmentosum. The remainder can readily be identified and excised separately.

Quelle: Photochemistry and Photobiology | 6 Feb 2015 | 7:08 am CET

Formulation of Aluminum Chloride Phthalocyanine in Pluronic™ P-123 and F-127 Block Copolymer Micelles: Photophysical properties and Photodynamic Inactivation of Microorganisms

Abstract

Aluminum Chloride Phthalocyanine (AlPcCl) can be used as a photosensitizer (PS) for Photodynamic Inactivation of Microorganisms (PDI). The AlPcCl showed favorable characteristics for PDI due to high quantum yield of singlet oxygen (ΦΔ) and photostability. Physicochemical properties and photodynamic inactivation of AlPcCl incorporated in polymeric micelles of tri-block copolymer (P-123 and F-127) against microorganisms Staphylococcus aureus, Escherichia coli and Candida albicans were investigated in this work. Previously, it was observed that the AlPcCl undergoes self-aggregation in F-127, while in P-123 the PS is in a monomeric form suitable for PDI. Due to the self-aggregation of AlPcCl in F-127, this formulation did not show any effect on these microorganisms. On the other hand, AlPcCl formulated in P-123 was effective against S. aureus and C. albicans and the death of microorganisms was dependent on the PS concentration and illumination time. Additionally, it was found that the values of PS concentration and illumination time to eradicate 90% of the initial population of microorganisms (IC90 and D90, respectively) were small for the AlPcCl in P-123, showing the effectiveness of this formulation for PDI.

Thumbnail image of graphical abstract

Formulations of aluminum chloride phthalocyanine were prepared in polymeric micelles of pluronic surfactants F-127 and P-123 and tested for inactivation of microorganisms. The process of incorporation of AlPcCl on copolymers was effective and the formulation obtained for the system AlPcCl/P-123 had good results against different kind of microorganisms.

Quelle: Photochemistry and Photobiology | 6 Feb 2015 | 7:07 am CET

Solar Spectral Irradiance and Summary Outputs Using Excel

Abstract

The development of an Excel spreadsheet is described that calculates solar spectral irradiance between 290–3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance and percentage of energy in different wavebands. A deliberate goal of the project was to adopt the principle of Ockham's razor and to develop a model that is as simple as it can be commensurate with delivering results of adequate accuracy. Consequently, just four inputs are required—geographical latitude, month, day of month and time of day—resulting in a spreadsheet that is easily usable by anyone with an interest in sunlight and solar power irrespective of their background. The accuracy of the calculated data is sufficient for many applications where knowledge of the ultraviolet, visible and infrared levels in sunlight is of interest.

Thumbnail image of graphical abstract

An Excel spreadsheet that calculates solar spectral irradiance between 290–3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance and percentage of energy in different wavebands. The spreadsheet is easy to use by anyone with an interest in sunlight and solar power irrespective of their background in that just four inputs are required—geographical latitude, month, day of month and time of day.

Quelle: Photochemistry and Photobiology | 6 Feb 2015 | 7:04 am CET

How green is green chemistry? Chlorophylls as a bioresource from biorefineries and their commercial potential in medicine and photovoltaics

Photochem. Photobiol. Sci., 2015, 14,638-660
DOI: 10.1039/C4PP00435C, Perspective
Aoife A. Ryan, Mathias O. Senge
Chlorophylls are the natural green pigments par excellence and offer potential as therapeutics and in energy generation. This perspective outlines the state-of-the-art, their possible applications and indicates future directions in the context of green chemistry and their production from biorefineries.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 3 Feb 2015 | 1:00 am CET

The alternative complement component factor B regulates UV-induced oedema, systemic suppression of contact and delayed hypersensitivity, and mast cell infiltration into the skin

Photochem. Photobiol. Sci., 2015, 14,801-806
DOI: 10.1039/C4PP00399C, Paper
Scott N. Byrne, Kirsten J. L. Hammond, Carling Y.-Y. Chan, Linda J. Rogers, Clare Beaugie, Sabita Rana, Felix Marsh-Wakefield, Joshua M. Thurman, Gary M. Halliday
UV wavelengths are the prime cause of skin cancer in humans with UVA and UVB contributing to photocarcinogenesis.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 3 Feb 2015 | 1:00 am CET

Time-resolved fluorescence anisotropy as a tool to study guest-cucurbit[n]uril-protein ternary supramolecular interactions

Photochem. Photobiol. Sci., 2015, 14,842-852
DOI: 10.1039/C4PP00479E, Paper
Karina Scholtbach, Italo Venegas, Cornelia Bohne, Denis Fuentealba
A combined time-resolved fluorescence and anisotropy analysis was used to study guest-cucurbit[n]uril-protein ternary supramolecular interactions in a model system.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 3 Feb 2015 | 1:00 am CET

Excited-State Multiple Proton Transfer Depending on the Acidity and Basicity of Mediating Alcohols in 7-Azaindole–(ROH)2 (R=H, CH3) Complexes: A Theoretical Study

Abstract

Long-range proton transfer plays an important role in many chemical and biological phenomena. It has recently been reported that the rate of excited-state multiple proton transfer depends on the acidity and basicity of mediating alcohols in the H-bonded wire. The excited-state triple proton transfer in 7-azaindole complexes through cyclic H-bonded wires was theoretically studied to investigate rates depending on the mediating alcohols. This study showed that the acidity and basicity of alcohols collectively functioned to assist proton transfers depending on the paths; the proton transfers of protolytic and solvolytic paths were assisted by the pull-behind effect and the push-ahead effect, respectively. Both proton-donating and accepting abilities of alcohols in the H-bonded wire can accumulate to help proton transfer, and the strong acidity and basicity of the alcohols with relatively small structural changes in the wire have larger impacts on reducing the activation energies than those of alcohols that trigger proton transfer.

Thumbnail image of graphical abstract

Both proton-donating and accepting abilities of alcohols in the H-bonded wire can accumulate to help proton transfer, and the strong acidity and basicity of the alcohols with relatively small structural changes in the wire have larger impacts on reducing the activation energies than those of alcohols that trigger proton transfer.

Quelle: Photochemistry and Photobiology | 2 Feb 2015 | 7:03 am CET

Light Treatment Improves Sleep Quality and Negative Affectiveness in High Arctic Residents During Winter

Abstract

The seasonal extremes of photoperiod in the high Arctic place particular strain on the human circadian system, which leads to trouble sleeping and increased feelings of negative affect in the winter months. To qualify for our study, potential participants had to have been at Canadian Forces Station (CFS) Alert (82° 30′ 00″ N) for at least 2 weeks. Subjects filled out questionnaires regarding sleep difficulty, psychological well-being and mood and wore Actigraphs to obtain objective sleep data. Saliva was collected at regular intervals on two occasions, 2 weeks apart, to measure melatonin and assess melatonin onset. Individuals with a melatonin rhythm that was in disaccord with their sleep schedule were given individualized daily light treatment interventions based on their pretreatment salivary melatonin profile. The light treatment prescribed to seven of the twelve subjects was effective in improving sleep quality both subjectively, based on questionnaire results, and objectively, based on the actigraphic data. The treatment also caused a significant reduction in negative affect among the participants. Since the treatment is noninvasive and has minimal associated side effects, our results support the use of the light visors at CFS Alert and other northern outposts during the winter for individuals who are experiencing sleep difficulty or low mood.

Thumbnail image of graphical abstract

Subjects residing at Canadian Forces Station (CFS) Alert (82° 30′ 00″ N) filled out questionnaires regarding sleep difficulty, psychological well-being and mood and wore Actigraphs to obtain objective sleep data. Saliva was collected prior to and following treatment to measure melatonin and assess melatonin onset. Individuals were given individualized daily light treatment interventions based on their pretreatment salivary melatonin profile. The light treatments were effective in improving sleep quality and reducing negative affect among the participants.

Quelle: Photochemistry and Photobiology | 2 Feb 2015 | 7:02 am CET

Measurement of Photosynthesis Using PAM Technology in a Purple Sulfur Bacterium Thermochromatium tepidum (Chromatiaceae)

Abstract

We demonstrate that Blue-diode-based pulse amplitude modulation (PAM) technology can be used to measure the photosynthetic electron transport rate (ETR) of purple sulfur bacteria (Thermochromatium tepidum, Chromatiaceae). Previous studies showed that PAM technology could be used to estimate photosynthesis in purple nonsulfur bacteria and so PAM technology can be used to estimate photosynthesis of both kinds of purple photosynthetic bacteria. The absorptance of Thermochromatium films on glass fiber disks was measured and used to calculate actual ETR. ETR vs Irradiance (P vs E) curves fitted the waiting-in-line model (ETR = (ETRmax × E/Eopt) × exp (1−E/Eopt)). Yield (Y) was only ≈ 0.3–0.4. Thermochromatium saturates at 325 ± 13.8 μmol photons m−2 s−1 or ≈15% sunlight and shows photoinhibition at high irradiances. A pond of Thermochromatium would exhibit classic surface inhibition. Photosynthesis is extremely low in the absence of an electron source: ETR increases in the presence of acetate (5 mol m−3) provided as an organic carbon source and also increases in the presence of sulfite (3 mol m−3) but not sulfide and is only marginally increased by the presence of Fe2+. Nonphotochemical quenching does occur in Thermochromatium but at very low levels compared to oxygenic photo-organisms or Rhodopseudomonads.

Thumbnail image of graphical abstract

Blue-Diode PAM Fluorescence technology can be used to monitor photosynthetic electron transport in Purple Sulfur Photosynthetic Bacteria. This is an important advance for bacterial photosynthetic studies because now photosynthesis of both purple sulfur and purple nonsulfur photosynthetic bacteria can be easily monitored without recourse to 14C methods in the laboratory and in lakes and microbial mats.

Quelle: Photochemistry and Photobiology | 31 Jan 2015 | 8:46 am CET

Spectroscopic Properties of Morin in Various CH3OH–H2O and CH3CN–H2O Mixed Solvents

Abstract

The specific fluorescence properties of morin (3,2′,4′,5,7-pentahydroxyflavone) were studied in various CH3OH–H2O and CH3CN–H2O mixed solvents. Although the dihedral angle is large in the S0 state, morin has an almost planar molecular structure in the S1 state owing to the very low rotational energy barrier around the interring bond between B and the A, C ring. The excited state intramolecular proton transfer (ESIPT) at the S1 state cannot occur immediately after excitation, S1 [RIGHTWARDS ARROW] S0 fluorescence can be observed. Two conformers, Morin A and B have been known. At the CH3OH–H2O, Morin B will be the principal species but at the CH3CN–H2O, Morin A is the principal species. At the CH3OH–H2O, owing to the large Franck–Condon (FC) factor for S2 [RIGHTWARDS ARROW] S1 internal convernal (IC) and flexible molecular structure, only S1 [RIGHTWARDS ARROW] S0 fluorescence was exhibited. At the CH3CN–H2O, as the FC factor for S2 [RIGHTWARDS ARROW] S1 IC is small and molecular structure is rigid, S2 [RIGHTWARDS ARROW] S0 and S1 [RIGHTWARDS ARROW] S0 dual fluorescence was observed. This abnormal fluorescence property was further supported by the small pK1 value, effective delocalization of the lone pair electrons of C(2′)–OH to the A, C ring, and a theoretical calculation.

Thumbnail image of graphical abstract

Steady-state fluorescence emission spectra of morin in CH3OH-H2O (A), and CH3CN-H2O mixed solvents (B). (A) λex = 390 nm; (1) 100% CH3OH (image), (2) 80% CH3OH (image), (3) 60% CH3OH (image), (4) 40% CH3OH (image); (B) λex = 365 nm; (1) 100% CH3CN (image), (2) 90% CH3CN (image), (3) 70% CH3OH (image), (4) 50% CH3OH (image).

Quelle: Photochemistry and Photobiology | 31 Jan 2015 | 8:37 am CET

The geometry relaxation and intersystem crossing of quaterthiophene studied by femtosecond spectroscopy

Photochem. Photobiol. Sci., 2015, 14,853-858
DOI: 10.1039/C4PP00439F, Paper
Si-mei Sun, Song Zhang, Kai Liu, Ya-ping Wang, Bing Zhang
The geometry relaxation in the singlet state and the intersystem crossing from relaxed singlet to triplet state are 70 and 398 ps, respectively.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 30 Jan 2015 | 1:00 am CET

Opening Enediyne Scissors Wider: pH-Dependent DNA Photocleavage by meta-Diyne Lysine Conjugates

Abstract

Photochemical activation of meta-diynes incapable of Bergman and C1–C5 cyclizations still leads to efficient double-strand DNA cleavage. Spatial proximity of the two arylethynyl groups is not required for efficient DNA photocleavage by the enediyne-lysine conjugates. Efficiency of the cleavage is a function of the external pH and DNA damage is strongly enhanced at pH < 7. The pH-dependence of the DNA photocleavage activity stems from the protonation states of lysine amino groups, the internal electron donors responsible for intramolecular PET quenching and deactivation of the photoreactive excited states. DNA-binding analysis suggests intercalative DNA binding for phenyl substituted conjugate and groove binding for TFP-substituted conjugate. Additional insights in the possible mechanism for DNA damage from the ROS (Reactive Oxygen Species) scavenger experiments found that generation of singlet oxygen is partially involved in the DNA damage.

Thumbnail image of graphical abstract

Upon photochemical activation, meta-bis-tetrafluoropyridinylalkyne-lysine conjugates induce pH-dependent DNA ds-photocleavage. Efficiency of DNA damage is strongly enhanced at pH < 7. The observed pH-dependence of the DNA photocleavage activity stems from change in the protonation states of lysine amino groups. The ROS (Reactive Oxygen Species) scavenger experiments suggest that singlet oxygen is partially involved in the DNA damage.

Quelle: Photochemistry and Photobiology | 29 Jan 2015 | 6:52 am CET

Low Level Light Therapy Modulates Inflammatory Mediators Secreted by Human Annulus Fibrosus Cells during Intervertebral Disc Degeneration In Vitro

Abstract

Intervertebral disc degeneration (IVD) is one of the important causes of low back pain and is associated with inflammation induced by interaction between macrophages and the human annulus fibrosus (AF) cells. Low-level light therapy (LLLT) has been widely known to regulate inflammatory reaction. However, the effect of LLLT on macrophage-mediated inflammation in the AF cells has not been studied till date. The aim of this study is to mimic the inflammatory microenvironment and to investigate the anti-inflammatory effect of LLLT at a range of wavelengths (405, 532 and 650 nm) on the AF treated with macrophage-like THP-1 cells conditioned medium (MCM) containing proinflammatory cytokines and chemokines (interleukin-1beta, tumor necrosis factor-alpha, interleukin-6 and 8). We observed that AF cells exposed to MCM secrete significantly higher concentrations of IL-6, IL-8, IL-1β and TNF-α. LLLT markedly inhibited secretion of IL-6 at 405 nm in a time-dependent manner. Level of IL-8 was significantly decreased at all wavelengths in a time-dependent manner. We showed that MCM can induce the inflammatory microenvironment in AF cells and LLLT selectively suppressed IL-6 and 8 levels. The results indicate that LLLT is a potential method of IVD treatment and provide insights into further investigation of its anti-inflammation effect on IVD.

Thumbnail image of graphical abstract

The aim of this study is to mimic the inflammatory microenvironment and investigate the anti-inflammatory effect of LLLT at a range of wavelengths (405, 532 and 650 nm) on the AF treated with macrophage-like THP-1 cells conditioned medium (MCM) containing proinflammatory cytokines and chemokines. AF cells exposed to MCM secreted significantly higher concentrations of IL-6, IL-8, IL-1β and TNF-α. LLLT markedly inhibited secretion of IL-6 at 405 nm in a time-dependent manner. Level of IL-8 was significantly decreased at all wavelengths in a time-dependent manner. We showed that MCM can induce the inflammatory microenvironment in AF cells and LLLT selectively suppressed IL-6 and 8 levels.

Quelle: Photochemistry and Photobiology | 27 Jan 2015 | 5:25 am CET

Photochemical synthesis of biocompatible and antibacterial silver nanoparticles embedded within polyurethane polymers

Photochem. Photobiol. Sci., 2015, 14,661-664
DOI: 10.1039/C4PP00404C, Communication
Sara Saez, Chiara Fasciani, Kevin G. Stamplecoskie, Luke Brian-Patrick Gagnon, Thien-Fah Mah, M. Luisa Marin, Emilio I. Alarcon, Juan C. Scaiano
In situ formed AgNP within polyurethane improved the antibacterial and antibiofilm activity against Pseudomonas aeruginosa with negligible toxicity for primary cells and erythrocytes.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 Jan 2015 | 1:00 am CET

Photoexcited triplet states of UV-B absorbers: ethylhexyl triazone and diethylhexylbutamido triazone

Photochem. Photobiol. Sci., 2015, 14,807-814
DOI: 10.1039/C4PP00373J, Paper
Takumi Tsuchiya, Azusa Kikuchi, Nozomi Oguchi-Fujiyama, Kazuyuki Miyazawa, Mikio Yagi
The lowest excited triplet state of a UV-B absorber with extremely high molecular extinction, ethylhexyl triazone, can be assigned to a locally excited 3[small pi][small pi]* state within a chromophore, p-(N-methylamino)benzoic acid.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 27 Jan 2015 | 1:00 am CET

Interaction of Crown Ether-Annelated Styryl Dyes with Double-Stranded DNA

Abstract

DNA-binding properties of 15-crown-5-derived mono- and bis-styryl dyes were investigated in the presence of calf thymus DNA. To access the factors that influence the DNA association in the series of these ligands, the structure of the molecules was varied by either changing size of the heterocyclic moiety or altering the position of the styryl substituents. The major binding mode for the monostyryl dyes is intercalation. Notably, binding of the dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54. Therefore, these cationic styryl derivatives may be applied as fluorescent “light-up” probes for DNA detection.

Thumbnail image of graphical abstract

Binding of 15-crown-5-derived mono- and bis-styryl dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54.

Quelle: Photochemistry and Photobiology | 23 Jan 2015 | 9:51 am CET

A safety study of a novel photosensitizer, sinoporphyrin sodium, for photodynamic therapy in Beagle dogs

Photochem. Photobiol. Sci., 2015, 14,815-832
DOI: 10.1039/C4PP00463A, Paper
Ni Lin, Chao Li, Zhonghua Wang, Jingxuan Zhang, Xiangfeng Ye, Wenjing Gao, Aiping Wang, Hongtao Jin, Jinfeng Wei
Sinoporphyrin sodium (DVDMS) based photodynamic therapy (PDT) showed skin phototoxicity in Beagle dogs, did not accumulate in blood plasma, and had an effect on the immune organs and the liver.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 23 Jan 2015 | 1:00 am CET

Cancer targeting with biomolecules: a comparative study of photodynamic therapy efficacy using antibody or lectin conjugated phthalocyanine-PEG gold nanoparticles

Photochem. Photobiol. Sci., 2015, 14,737-747
DOI: 10.1039/C4PP00312H, Paper
Girgis Obaid, Isabelle Chambrier, Michael J. Cook, David A. Russell
The functionalisation of therapeutic nanoparticle constructs with cancer-specific biomolecules can enable selective tumour accumulation and targeted treatment.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 21 Jan 2015 | 1:00 am CET

Intramolecular Proton Transfer in 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine: Evidence for Tautomer in the Ground State

Abstract

The intramolecular proton transfer in a newly synthesized molecule, 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine (HPOP) is studied using UV-visible absorption, fluorescence emission, fluorescence excitation and time-resolved fluorescence spectroscopy. In the ground state, the molecule exists as cis- and trans-enol in all the solvents. However, in dioxane, alcohols, acetonitrile, dimethylformamide and dimethylsulfoxide the keto tautomer is also observed in the ground state. Dual fluorescence is observed in HPOP where the large Stoke shifted emission is due to emission from the excited-state intramolecular proton transfer product, whereas the other emission is the normal emission from enol form. The fluorescence (both normal and tautomer emission) of HPOP is less than those of corresponding benzoxazole and imidazopyridine derivatives. This reveals that the nonradiative decay becomes more efficient upon substitution of electronegative atom on the charge acceptor group. The pH studies substantiate the conclusion that (unlike in its imidazole analog) the third ground state species is the keto tautomer and not the monoanion. The effect of temperature on cis-enol-trans-enol-keto equilibrium and the nonradiative deactivation from the excited state are also investigated.

Thumbnail image of graphical abstract

Unlike its analogs 2-(2′-hydroxyphenyl)oxazolo[4,5-b]pyridine exists as keto tautomer along as enol in the ground state in several solvents.

Quelle: Photochemistry and Photobiology | 20 Jan 2015 | 6:15 am CET

Influence of Trans Fat on Skin Damage in First-Generation Rats Exposed to UV Radiation

Abstract

The influence of trans fatty acids (TFA) on lipid profile, oxidative damage and mitochondrial function in the skin of rats exposed to ultraviolet radiation (UVR) was assessed. The first-generation offspring of female Wistar rats supplemented from pregnancy with either soybean oil (C-SO, rich in n–6 FA; control group) or hydrogenated vegetable fat (HVF, rich in TFA) were continued with the same supplements until adulthood, when half of each group was exposed to UVR for 12 weeks. The HVF group showed higher TFA cutaneous incorporation, increased protein carbonyl (PC) levels, decreased functionality of mitochondrial enzymes and antioxidant defenses of the skin. After UVR, the HVF group showed increased skin thickness and reactive species (RS) generation, with decreased skin antioxidant defenses. RS generation was positively correlated with skin thickness, wrinkles and PC levels. Once incorporated to skin, TFA make it more susceptible to developing UVR-induced disorders.

Thumbnail image of graphical abstract

Metabolism of trans fat by COX and LOX: The dietary intake of trans fat favors the synthesis of biologically active prostanoids produced during inflammatory processes. After ultraviolet radiation exposure, trans fat supplementation, which is rich in trans fatty acids (TFA), increases the skin thickness, reactive species generation and decreases the skin antioxidant defenses.

Quelle: Photochemistry and Photobiology | 20 Jan 2015 | 6:12 am CET

Light-controlled release of nitric oxide from solid polymer composite materials using visible and near infra-red light

Photochem. Photobiol. Sci., 2015, 14,775-785
DOI: 10.1039/C4PP00441H, Paper
Jonathan D. Mase, Anton O. Razgoniaev, Megan K. Tschirhart, Alexis D. Ostrowski
Composite materials were prepared using biocompatible polymers, upconverting nanoparticles, and a nitric oxide (NO) donor complex. We have demonstrated NO release from the solid composites after visible and near infra-red light irradiation.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Jan 2015 | 1:00 am CET

Photogenerated lophyl radicals in 1-alkyl-3-vinylimidazolium bis(trifluoromethylsulfonyl)imides

Photochem. Photobiol. Sci., 2015, 14,714-725
DOI: 10.1039/C4PP00386A, Paper
Stefan Berdzinski, Bernd Strehmel, Veronika Strehmel
1-Alkyl-3-vinylimidazolium bis(trifluoromethylsulfonyl)imides were investigated as a matrix for photogenerated lophyl radicals obtained by irradiation of o-chlorohexaarylbisimidazole (o-Cl-HABI).
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Jan 2015 | 1:00 am CET

Growth under Visible Light Increases Conidia and Mucilage Production and Tolerance to UV-B Radiation in the Plant Pathogenic Fungus Colletotrichum acutatum

Abstract

Light conditions can influence fungal development. Some spectral wavebands can induce conidial production, whereas others can kill the conidia, reducing the population size and limiting dispersal. The plant pathogenic fungus Colletotrichum acutatum causes anthracnose in several crops. During the asexual stage on the host plant, Colletototrichum produces acervuli with abundant mucilage-embedded conidia. These conidia are responsible for fungal dispersal and host infection. This study examined the effect of visible light during C. acutatum growth on the production of conidia and mucilage and also on the UV tolerance of these conidia. Conidial tolerance to an environmentally realistic UV irradiance was determined both in conidia surrounded by mucilage on sporulating colonies and in conidial suspension. Exposures to visible light during fungal growth increased production of conidia and mucilage as well as conidial tolerance to UV. Colonies exposed to light produced 1.7 times more conidia than colonies grown in continuous darkness. The UV tolerances of conidia produced under light were at least two times higher than conidia produced in the dark. Conidia embedded in the mucilage on sporulating colonies were more tolerant of UV than conidia in suspension that were washed free of mucilage. Conidial tolerance to UV radiation varied among five selected isolates.

Thumbnail image of graphical abstract

Light conditions influence the development of the plant pathogenic fungus Colletotrichum acutatum. Exposures to visible light during fungal growth increased production of conidia and mucilage as well as conidial tolerance to UV. Conidia embedded in the mucilage on sporulating colonies were more tolerant of UV than conidia in suspension that were washed free of mucilage.

Quelle: Photochemistry and Photobiology | 16 Jan 2015 | 5:36 am CET

The effect of a "push-pull" structure on the turn-on fluorescence of photochromic thio-ketone type diarylethenes

Photochem. Photobiol. Sci., 2015, 14,765-774
DOI: 10.1039/C4PP00320A, Paper
Shichong Pang, Daeun Jang, Woo Sun Lee, Hyeok-Mo Kang, Seung-Ju Hong, Sung Kwan Hwang, Kwang-Hyun Ahn
A diarylethene with a six-membered ring carrying an electron-donating sulfur atom and an electron-withdrawing carbonyl group shows fluorescence in its ring-closed state.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 16 Jan 2015 | 1:00 am CET

Molecular Regulation of UV-Induced DNA Repair

Abstract

Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the United States, as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors.

Thumbnail image of graphical abstract

UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing affected individuals to carcinogenesis as well as to premature aging. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors.

Quelle: Photochemistry and Photobiology | 14 Jan 2015 | 6:55 am CET

Synthesis of Bi2WO6/Bi2O3 Composite with Enhanced Photocatalytic Activity by a Facile One-step Hydrothermal Synthesis Route

Abstract

In this study, the characterization and photocatalytic activity of Bi2WO6/Bi2O3 under visible-light irradiation was investigated in detail. The results suggested that Bi2WO6/Bi2O3 can be synthesized by a facile one-pot hydrothermal route using a super big 200 mL Teflon-lined autoclave with optimal sodium oleate/Bi molar ratio of 1.25. Through the characterization of Bi2WO6/Bi2O3 by X-ray diffraction, scanning electron microscopy, X-ray photoelectron spectroscopy, Fourier transform infrared, UV-vis diffuse reflectance spectra and Photoluminescence spectra, it was found that the as-prepared composite possessed smaller crystallite size and higher visible-light responsive than the pure Bi2WO6. Moreover, it was expected that the as-prepared composites exhibited enhanced photocatalytic activity for the degradation of Rhodamine B under visible-light irradiation, which could be ascribed to their improved light absorption property and the reduced recombination of the photogenerated electrons and holes during the photocatalytic reaction. In general, this study could provide a principle method to synthesize Bi2WO6/Bi2O3 with enhanced photocatalytic activity by one-step hydrothermal synthesis route for environmental purification.

Thumbnail image of graphical abstract

Bi2WO6/Bi2O3 can be synthesized by a facile one-pot hydrothermal route with sodium oleate using a super big 200 mL Teflon-lined autoclave. The as-prepared composites possessed smaller band gap and higher visible-light responsive than the pure Bi2WO6. The as-prepared composites exhibited enhanced photocatalytic activity for the degradation of RhB under visible-light irradiation, which could be ascribed to their improved light absorption property and the reduced recombination of the photogenerated electrons and holes during the photocatalytic reaction.

Quelle: Photochemistry and Photobiology | 14 Jan 2015 | 6:54 am CET

Response of Growth and Photosynthesis of Emiliania huxleyi to Visible and UV Irradiances under Different Light Regimes

Abstract

Microalgae are capable of acclimating to changes in light and ultraviolet radiation (UVR, 280–400 nm). However, little is known about how the ecologically important coccolithophore Emiliania huxleyi responds to UVR when acclimated to different light regimes. Here, we grew E. huxleyi under indoor constant light or fluctuating sunlight with or without UVR, and investigated its growth, photosynthetic performance and pigmentation. Under the indoor constant light regime, the specific growth rate (μ) was highest, while fluctuating outdoor solar radiation significantly decreased the growth rate. Addition of UVR further decreased the growth rate. The repair rate of photosystem II (PSII), as reflected in changes in PSII quantum yield, showed an inverse correlation with growth rate. Cells grown under the indoor constant light regime exhibited the lowest repair rate, while cells from the outdoor fluctuating light regimes significantly increased their repair rate. Addition of UVR increased both the repair rate and intracellular UV-absorbing compounds. This increased repair capability, at the cost of decreased growth rate, persisted after the cells were transferred back to the indoor again, suggesting an enhanced allocation of energy and resources for repair of photosynthetic machinery damage by solar UVR which persisted for a period after transfer from solar UVR.

Thumbnail image of graphical abstract

We grew calcifying Emiliania huxleyi under indoor constant light and fluctuating sunlight regimes with or without UV radiation. The growth rate was the highest under the indoor, significantly decreased under fluctuating outdoor solar radiation, especially in the presence of UV radiation. When the UV-exposed cells were regrown under indoor light, the growth recovered slowly, which were predicted to take a month to catch the previous indoor growth rate. The results indicate that the cells, while growing under fluctuating light, require additional energy and resources for maintaining photosynthetic machinery and synthesizing UV-absorbing compounds at the cost of decreased growth rate.

Quelle: Photochemistry and Photobiology | 14 Jan 2015 | 6:52 am CET

Effects of Substituents on Synthetic Analogs of Chlorophylls. Part 4: How Formyl Group Location Dictates the Spectral Properties of Chlorophylls b, d and f

Abstract

Photosynthetic organisms are adapted to light characteristics in their habitat in part via the spectral characteristics of the associated chlorophyll pigments, which differ in the position of a formyl group around the chlorin macrocycle (chlorophylls b, d, f) or no formyl group (chlorophyll a). To probe the origin of this spectral tuning, the photophysical and electronic structural properties of a new set of synthetic chlorins are reported. The zinc and free base chlorins have a formyl group at either the 2- or 3-position. The four compounds have fluorescence yields in the range 0.19–0.28 and singlet excited-state lifetimes of ca 4 ns for zinc chelates and ca 8 ns for the free base forms. The photophysical properties of the 2- and 3-formyl zinc chlorins are similar to those observed previously for 13-formyl or 3,13-diformyl chlorins, but differ markedly from those for 7-formyl analogs. Molecular-orbital characteristics obtained from density functional theory (DFT) calculations were used as input to spectral simulations employing the four-orbital model. The analysis has uncovered the key changes in electronic structure engendered by the presence/location of a formyl group at various macrocycle positions, which is relevant to understanding the distinct spectral properties of the natural chlorophylls a, b, d and f.

Thumbnail image of graphical abstract

The location of the formyl group at the perimeter of the chlorin ring has a profound effect on the position of the long-wavelength chlorin absorption band. Photophysical studies of synthetic formyl chlorins combined with DFT calculations and use of the tetrapyrrole four-orbital model have identified the molecular physical origin of the observed spectral shifts.

Quelle: Photochemistry and Photobiology | 12 Jan 2015 | 7:13 am CET

Nobiletin, a Polymethoxy Flavonoid, Reduced Endothelin-1 Plus SCF-Induced Pigmentation in Human Melanocytes

Abstract

Nobiletin is a unique flavonoid having polymethoxy groups and has exhibited anti-inflammatory and antiobesity effects. Here, we examined the inhibition of nobiletin on melanogenesis induced by endothelin-1 (ET) and stem cell factor (SCF) in normal human melanocytes. Nobiletin dose dependently reduced ET plus SCF-stimulated tyrosinase activity without causing cytotoxicity. Nobiletin reduced cAMP-response element-binding protein (CREB) phosphorylation and microphthalmia-associated transcription factor (MITF) expression, which is a key transcription factor for tyrosinase expression in pigmentation induced by ET plus SCF stimulation. Nobiletin treatment effectively decreased ET plus SCF-induced Raf-1, MEK and ERK1/2 phosphorylation and also downregulated the forskolin-induced phosphorylation of CREB. Furthermore, nobiletin inhibited ET plus SCF-triggered production of melanin and expression of MITF/tyrosinase in a three-dimensional human epidermal model. In accordance with protein expression, the expression of genes related to the pigmentation was also increased in the cells stimulated with ET plus SCF and the cotreatment with nobiletin decreased obviously the ET plus SCF-triggered gene expressions of tyrosinase, PMEL, TRP1 and MITF. Nobiletin contributes to hypopigmentation by downregulating MITF and tyrosinase expression through reduced Raf-1 phosphorylation. Our findings implicate nobiletin as a potential new whitening agent.

Thumbnail image of graphical abstract

Nobiletin inhibited ET plus SCF-triggered production of melanin and expression of MITF/tyrosinase in human melanocytes and a three-dimensional human epidermal model. This is the first research emphasizing the antimelanogenesis potential of nobiletin isolated from citrus and its possibility of beneficial applications in the cosmetic industry.

Quelle: Photochemistry and Photobiology | 12 Jan 2015 | 6:58 am CET

Gramicidin conformational changes during riboflavin photosensitized oxidation in solution and the effect of N-methylation of tryptophan residues

Photochem. Photobiol. Sci., 2015, 14,748-756
DOI: 10.1039/C4PP00414K, Paper
Denis Fuentealba, Jhon J. Lopez, Marco Palominos, Cristian O. Salas, Marco A. Soto-Arriaza
During riboflavin mediated photo-oxidation, gramicidin changes from intertwined to monomeric conformation (disaggregation), while the methylated derivative is not photo-oxidized.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Jan 2015 | 1:00 am CET

Untangling interactions of a zinc(II) complex containing a coumarin-porphyrin unit with alkaloids in water solutions: a photophysical study

Photochem. Photobiol. Sci., 2015, 14,757-764
DOI: 10.1039/C4PP00359D, Paper
Carla I. M. Santos, Elisabete Oliveira, Hugo M. Santos, Jose C. J. M. D. S. Menezes, M. Amparo F. Faustino, Jose A. S. Cavaleiro, J. L. Capelo, Maria da Graca P. M. S. Neves, Carlos Lodeiro
A metal complex 1 derivative from a coumarin bearing a porphyrin unit is sensitive to the alkaloids caffeine 2, nicotine 3 and cotinine 4 in solution and/or in the gas phase.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 12 Jan 2015 | 1:00 am CET

Effects of Ultraviolet Radiation (UVA+UVB) and Copper on the Morphology, Ultrastructural Organization and Physiological Responses of the Red Alga Pterocladiella capillacea

Abstract

The effect of ultraviolet (UV) radiation and copper (Cu) on apical segments of Pterocladiella capillacea was examined under two different conditions of radiation, PAR (control) and PAR+UVA+UVB (PAR+UVAB), and three copper concentrations, ranging from 0 (control) to 0.62, 1.25 and 2.50 μm. Algae were exposed in vitro to photosynthetically active radiation (PAR) at 70 μmol photons m−2 s−1, PAR + UVB at 0.35 W m−2 and PAR +UVA at 0.70 W m−2 during a 12-h photocycle for 3 h each day for 7 days. The effects of radiation and copper on growth rates, content of photosynthetic pigments and photosynthetic performance were analyzed. In addition, samples were processed for light and transmission electron microscopy. The content of photosynthetic pigments decreased after exposure to radiation and Cu. Compared with PAR radiation and copper treatments modified the kinetics patterns of the photosynthesis/irradiance curve. The treatments also caused changes in the ultrastructure of cortical and subcortical cells, including increased cell wall thickness and accumulation of plastoglobuli, as well as changes in the organization of chloroplasts. The results indicate that the synergistic interaction between UV radiation and Cu in P. capillacea, led to the failure of protective mechanisms and causing more drastic changes and cellular imbalances.

Thumbnail image of graphical abstract

This study shows that both ultraviolet radiation (UVR) and copper (Cu) have deleterious effects on the macroalgae Pterocladiella capillacea, which toxicity led to drastic cellular changes and failure of protective mechanisms. Although UV radiation demonstrated to be more harmful than Cu, our results clearly indicate a synergistic interaction between the two stressors.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 12:42 pm CET

Forty Years of Research on Xeroderma Pigmentosum at the US National Institutes of Health

Abstract

In 1968, Dr. James Cleaver reported defective DNA repair in cultured cells from patients with xeroderma pigmentosum. This link between clinical disease and molecular pathophysiology has sparked interest in understanding not only the clinical characteristics of sun sensitivity, damage and cancer that occurred in XP patients but also the mechanisms underlying the damage and repair. While affected patients are rare, their exaggerated UV damage provides a window into the workings of DNA repair. These studies have clarified the importance of a functioning DNA repair system to the maintenance of skin and neurologic health in the general population. Understanding the role of damage in causing cancer, neurologic degeneration, hearing loss and internal cancers provides an opportunity for prevention and treatment. Characterizing complementation groups pointed to the importance of different underlying genes. Studying differences in cancer age of onset and underlying molecular signatures in cancers occurring either in XP patients or the general population has led to insights into differences in carcinogenic mechanisms. The accelerated development of cancers in XP has been used as a model to discover new cancer chemopreventive agents. An astute insight can be a “tipping point” triggering decades of productive inquiry.

Thumbnail image of graphical abstract

James Cleaver's 1968 report of defective DNA repair in patients with xeroderma pigmentosum (XP) inspired scientists at the National Institutes of Health to initiate long-term studies of patients with XP and related disorders. These have led to a better understanding of the role of DNA repair in protection from sunlight-induced cancer of the skin and eyes, in maintaining the integrity of the nervous system and in human development. XP serves as a model of the effectiveness of sun protection and of oral retinoids in prevention of skin cancers.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 12:42 pm CET

Thioredoxin Reductase Activity may be More Important than GSH Level in Protecting Human Lens Epithelial Cells against UVA Light

Abstract

This study compares the abilities of the glutathione (GSH) and thioredoxin (Trx) antioxidant systems in defending cultured human lens epithelial cells (LECs) against UVA light. Levels of GSH were depleted with either L-buthionine-(S,R)-sulfoximine (BSO) or 1-chloro-2,4-dinitrobenzene (CDNB). CDNB treatment also inhibited the activity of thioredoxin reductase (TrxR). Two levels of O2, 3% and 20%, were employed during a 1 h exposure of the cells to 25 J cm−2 of UVA radiation (338–400 nm wavelength, peak at 365 nm). Inhibition of TrxR activity by CDNB, combined with exposure to UVA light, produced a substantial loss of LECs and cell damage, with the effects being considerably more severe at 20% O2 compared to 3%. In contrast, depletion of GSH by BSO, combined with exposure to UVA light, produced only a slight cell loss, with no apparent morphological effects. Catalase was highly sensitive to UVA-induced inactivation, but was not essential for protection. Although UVA light presented a challenge for the lens epithelium, it was well tolerated under normal conditions. The results demonstrate an important role for TrxR activity in defending the lens epithelium against UVA light, possibly related to the ability of the Trx system to assist DNA synthesis following UVA-induced cell damage.

Thumbnail image of graphical abstract

Exposure of cultured human lens epithelial cells (LECs) to UVA light (25 J cm−2), or pretreatment of the cells with an inhibitor (1-chloro-2,4-dinitrobenzene) of thioredoxin reductase (TrxR), produced no damaging cellular effects. However, a combination of the two challenges produced substantial loss of LECs and cell damage, including death (arrows) and threadlike structures (arrowheads). In contrast, depletion of reduced glutathione (GSH) by L-buthionine-(S,R)-sulfoximine, combined with exposure to UVA light, produced only a slight cell loss, with no apparent morphological effects. The results demonstrate an important role for TrxR activity, possibly more so than GSH level, in defending the lens epithelium against UVA light.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 10:04 am CET

Unveiling the Triplet State of a 4-Amino-7-Nitrobenzofurazan Derivative in Cyclohexane

Abstract

The nitrobenzofurazan (NBD) moiety has gained tremendous popularity over the last decades due to its fluorogenic nature. Indeed, upon interaction with aliphatic amines, it generates a stable fluorescent adduct, which has been used for protein and lipid labeling. In fact the 4-amino substituted NBD belongs to the broad family of intramolecular charge transfer molecules, with the amino group acting as an electron donor upon photoexcitation, and the nitro group as an electron acceptor. Although the singlet excited state of 4-amino NBD derivatives has been abundantly studied, investigation of its triplet manifold is scarce and even the absence of intersystem crossing for this type of molecules has been suggested. However, intramolecular charge transfer molecules are known to undergo intersystem crossing and high phosphorescence quantum yields have been reported in a nonpolar solvent. In the present paper, we have investigated the photophysical and photochemical properties of N-hexyl-7-nitrobenzo[c][1,2,5]xadiazole-4-amine. We have shown the existence of a triplet state for this molecule in cyclohexane via nanosecond laser flash photolysis. Interestingly, deactivation of the triplet state leads to photoproducts formation, which are only present in the absence of oxygen.

Thumbnail image of graphical abstract

While NBD derivatives are very popular fluorogenic compounds and their first excited states are well characterized, no study had investigated the ability of these compounds to undergo intersystem crossing. As many other intramolecular charge transfer molecules, NBD derivatives present a triplet state in a nonpolar solvent such as cyclohexane.

Quelle: Photochemistry and Photobiology | 8 Jan 2015 | 10:02 am CET

Hyperactive Arg39Lys mutated mnemiopsin: implication of positively charged residue in chromophore binding cavity

Photochem. Photobiol. Sci., 2015, 14,792-800
DOI: 10.1039/C4PP00191E, Paper
Atiyeh Mahdavi, Reza H. Sajedi, Saman Hosseinkhani, Majid Taghdir
Mnemiopsin, a Ca2+-regulated photoprotein isolated from Mnemiopsis leidyi, belongs to the family of ctenophore photoproteins. While there are no charged amino acid residues in the coelenterazine binding cavity of cnidarian photoproteins, ctenophore photoproteins have a positively charged residue (Arg) in this region.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 Jan 2015 | 1:00 am CET

Excitonic dynamics of Chlorophyll-a molecules in chitosan hydrogel scaffold

Photochem. Photobiol. Sci., 2015, 14,786-791
DOI: 10.1039/C4PP00305E, Paper
Pubali Mandal, Jhimli Sarkar Manna, Debmallya Das, Manoj Kumar Mitra
Non-coherent energy hopping (hopping rate 4.28 ns-1) through excitonically coupled 23[degree] aligned Chl-a molecules within chitosan hydrogel matrix, for an artificial light harvesting system.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 7 Jan 2015 | 1:00 am CET

Photochemistry of N-(selenoalkyl)-phthalimides. Formation of N, Se-heterocyclic systems

Photochem. Photobiol. Sci., 2015, 14,726-736
DOI: 10.1039/C4PP00452C, Paper
Gabriela Oksdath-Mansilla, Adrian A. Heredia, Juan E. Arguello, Alicia B. Penenory
A number of selenium heterocyclic derivatives are obtained upon direct or acetone-sensitized irradiation of a variety of N-(selenomethyl)alkyl-phthalimides. The reaction proceeds by photoinduced intramolecular electron transfer between the Se atom and the phthalimide moiety.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 6 Jan 2015 | 1:00 am CET

Improved Efficiency and Stability of Flexible Dye Sensitized Solar Cells on ITO/PEN Substrates Using an Ionic Liquid Electrolyte

Abstract

Flexible dye-sensitized solar cells (DSSCs) built on plastic substrates have attracted great interest as they are lightweight and can be roll-to-roll printed to accelerate production and reduce cost. However, plastic substrates such as PEN and PET are permeable to water, oxygen and volatile electrolyte solvents, which is detrimental to the cell stability. Therefore, to address this problem, in this work, an ionic liquid (IL) electrolyte is used to replace the volatile solvent electrolyte. The initial IL-based devices only achieved around 50% of the photovoltaic conversion efficiency of the cells using the solvent electrolyte. Current-voltage and electrochemical impedance spectroscopy (EIS) analysis of the cells in the dark indicated that this lower efficiency mainly originated from (i) a lack of blocking layer to reduce recombination, and (ii) a lower charge collection efficiency. To combat these problems, cells were developed using a 12 nm thick blocking layer, produced by atomic layer deposition, and 1 μm thick P25 TiO2 film sensitized with the hydrophobic MK-2 dye. These flexible DSSCs utilizing an IL electrolyte exhibit significantly improved efficiencies and a <10% drop in performance after 1000 h aging at 60°C under continuous light illumination.

Thumbnail image of graphical abstract

Flexible dye-sensitized solar cells (DSSCs) with enhanced stability, built on ITO/PEN substrates and using an ionic liquid (IL) electrolyte, have been developed. A 12 nm thick blocking layer, produced by atomic layer deposition, was used to reduce electron recombination, and a 1 μm thick TiO2 film sensitized with the hydrophobic MK-2 dye was used to improve charge collection and extraction. These flexible DSSCs exhibit comparable efficiency to those cells using a solvent based electrolyte plus significantly improved stability, with a <10% drop in performance after 1000 h aging at 60°C under continuous light illumination.

Quelle: Photochemistry and Photobiology | 30 Dec 2014 | 6:49 am CET

Application of CdTe/ZnSe Quantum Dots in In Vitro Imaging of Chicken Tissue and Embryo

Abstract

The present work is aimed to synthesize CdTe/ZnSe core/shell quantum dots (QDs) in an easy way and to explore the possibilities of its application in in vitro imaging of chicken tissue and embryo. The QDs were prepared using microwave irradiation with different temperatures, which is a very easy and less time-consuming method. Subsequently, these QDs were characterized by spectrofluorimetry, Transmission Electron Microscopy, X-ray fluorescence analysis and Dynamic Light Scattering measurement. A blueshifting of the emission was found when ZnSe was deposited on CdTe QDs. The QDs showed its fluorescence emission quantum yields up to 25%. They were applied into chicken embryos and breast muscle tissues to study their efficiency in in vitro imaging. All the QDs of different color were able to visualize in in vitro imaging. The highest fluorescence intensity was detected in the case of red QDs prepared at 100°C. The green and red QDs were possible to detect up to the depth of 3 and 4 mm of the tissue, respectively.

Thumbnail image of graphical abstract

CdTe/ZnSe core/shell quantum dots (QDs) were prepared using microwave irradiation with different temperatures which is a very easy and less time-consuming method. The QDs were characterized by spectrofluorimetry, TEM, X-ray fluorescence analysis and Dynamic Light Scattering measurement. A blueshifting of the emission was found when ZnSe was deposited on CdTe QDs. All the QDs were able to visualize in in vitro imaging of chicken tissue and embryo and the QDs prepared at 100°C showed the best result.

Quelle: Photochemistry and Photobiology | 30 Dec 2014 | 6:45 am CET

Low-level Laser (Light) Therapy Increases Mitochondrial Membrane Potential and ATP Synthesis in C2C12 Myotubes with a Peak Response at 3–6 h

Abstract

Low-level laser (light) therapy has been used before exercise to increase muscle performance in both experimental animals and in humans. However, uncertainty exists concerning the optimum time to apply the light before exercise. The mechanism of action is thought to be stimulation of mitochondrial respiration in muscles, and to increase adenosine triphosphate (ATP) needed to perform exercise. The goal of this study was to investigate the time course of the increases in mitochondrial membrane potential (MMP) and ATP in myotubes formed from C2C12 mouse muscle cells and exposed to light-emitting diode therapy (LEDT). LEDT employed a cluster of LEDs with 20 red (630 ± 10 nm, 25 mW) and 20 near-infrared (850 ± 10 nm, 50 mW) delivering 28 mW cm2 for 90 s (2.5 J cm2) with analysis at 5 min, 3 h, 6 h and 24 h post-LEDT. LEDT-6 h had the highest MMP, followed by LEDT-3 h, LEDT-24 h, LEDT-5 min and Control with significant differences. The same order (6 h > 3 h > 24 h > 5 min > Control) was found for ATP with significant differences. A good correlation was found (r = 0.89) between MMP and ATP. These data suggest an optimum time window of 3–6 h for LEDT stimulate muscle cells.

Thumbnail image of graphical abstract

Mechanism of action of LLLT or LEDT on mitochondria in muscle cells. There is an increased flux of electrons through all the complexes of the electron transport chain, increased pumping of H+, increased synthesis of ATP and increased mitochondrial membrane potential as shown by TMRM fluorescence. The result is that muscles can perform much more work when light is delivered 3–6 h before exercise.

Quelle: Photochemistry and Photobiology | 30 Dec 2014 | 6:32 am CET

Absorption and Emission Sensitivity of 2-(2′-Hydroxyphenyl)benzoxazole to Solvents and Impurities

Abstract

2-(2′-Hydroxyphenyl)benzoxazole (HBO) is known for undergoing intramolecular proton transfer in the excited state to result in the emission of its tautomer. A minor long-wavelength absorption band in the range 370–420 nm has been reported in highly polar solvents such as dimethylsulfoxide (DMSO). However, the nature of this species has not been entirely clarified. In this work, we provide evidence that this long-wavelength absorption band might have been caused by base or metal salt impurities that are introduced into the spectral sample during solvent transport using glass Pasteur pipettes. The contamination by base or metal salt could be avoided by using borosilicate glass syringes or nonglass pipettes in sample handling. Quantum chemical calculations conclude that solvent-mediated deprotonation is too energetically costly to occur without the aid of a base of an adequate strength. In the presence of such a base, the deprotonation of HBO and its effect on emission are investigated in dichloromethane and DMSO, the latter of which facilitates deprotonation much more readily than the former. Finally, the absorption and emission spectra of HBO in 13 solvents are reported, from which it is concluded that ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

Thumbnail image of graphical abstract

Minor long-wavelength absorption bands of the excited state intramolecular proton transfer (ESIPT) dye 2-(2′-hydroxyphenyl)benzoxazole (HBO) have been observed in DMSO by us and others. These bands might have been caused by base or metal salt impurities introduced by glass Pasteur pipettes that are equipped with latex rubber bulbs. Without the interference of extraneous bases or metal salts, solvent-mediated deprotonation fails to occur. The propensity of HBO to deprotonation is much higher in DMSO than in less polar solvents. The solvatochromic shifts of HBO suggest that the ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

Quelle: Photochemistry and Photobiology | 24 Dec 2014 | 5:56 am CET

Steric and Electronic Factors Associated with the Photoinduced Ligand Exchange of Bidentate Ligands Coordinated to Ru(II)

Abstract

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT), the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complexes 1 and 2 were compared to [Ru(bpy)2(dpb)](PF6)2 (3, bpy = 2,2′-bipyridine) and [Ru(biq)2(phen)](PF6)2 (4, phen = 1,10-phenanthroline). Distortions around the metal and biq ligands were used to explain the exchange of one biq ligand in 4 upon irradiation. Complex 1, however, undergoes photoinduced dissociation of the dpb ligand rather than biq under analogous experimental conditions. Complex 3 is not photoactive, providing evidence that the biq ligands are crucial for ligand photodissociation in 1. The crystal structures of 1 and 4 are compared to explain the difference in photochemistry between the complexes. Complex 2 absorbs lower energy light than 1, but is photochemically inert although its crystal structure displays significant distortions. These results indicate that both the excited state electronic structure and steric bulk play key roles in bidentate photoinduced ligand dissociation. The present work also shows that it is possible to stabilize sterically hindered Ru(II) complexes by the addition of another metal, a property that may be useful for other applications.

Thumbnail image of graphical abstract

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT) with easily tunable excited state properties, the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complex 1 undergoes photoinduced ligand dissociation of the dpb ligand in coordinating solvent in the PCT window, however, the bimetallic complex is photoinert but does absorb lower energy light. The differences in the photophysical properties and the crystal structures of the complexes are discussed and used to explain the differences in photoreactivity.

Quelle: Photochemistry and Photobiology | 23 Dec 2014 | 8:19 am CET

The singlet-oxygen-sensitized delayed fluorescence in mammalian cells: a time-resolved microscopy approach

Photochem. Photobiol. Sci., 2015, 14,700-713
DOI: 10.1039/C4PP00339J, Paper
Marek Scholz, Anna-Louisa Biehl, Roman Dedic, Jan Hala
Microsecond kinetics of singlet-oxygen-sensitized delayed fluorescence (SOSDF) have been detected from individual living fibroblast cells as a proof-of-concept. These provide valuable information about excited state lifetimes and their changes during PDT-like treatment.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 23 Dec 2014 | 1:00 am CET

Degradation of two fluoroquinolone antibiotics photoinduced by Fe(III)-microalgae suspension in an aqueous solution

Photochem. Photobiol. Sci., 2015, 14,693-699
DOI: 10.1039/C3PP50149C, Paper
Liyun Ge, Huanhuan Deng
Two fluoroquinolone (FQ) antibiotics, enrofloxacin (ENR) and ciprofloxacin hydrochloride (CIP), and two marine microalgae, Platymonas subcordiformis and Isochrysis galbana, were investigated under irradiation with a high-pressure mercury lamp (HPML) in a laboratory-scale experiment.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 23 Dec 2014 | 1:00 am CET

Regulation and Disregulation of Mammalian Nucleotide Excision Repair: A Pathway to Nongermline Breast Carcinogenesis

Abstract

Nucleotide excision repair (NER) is an important modulator of disease, especially in constitutive deficiencies such as the cancer predisposition syndrome Xeroderma pigmentosum. We have found profound variation in NER capacity among normal individuals, between cell-types and during carcinogenesis. NER is a repair system for many types of DNA damage, and therefore many types of genotoxic carcinogenic exposures, including ultraviolet light, products of organic combustion, metals and oxidative stress. Because NER is intimately related to cellular metabolism, requiring components of both the DNA replicative and transcription machinery, it has a narrow range of functional viability. Thus, genes in the NER pathway are expressed at the low levels manifested by, for example, nuclear transcription factors. As NER activity and gene expression vary by cell-type, it is inherently epigenetically regulated. Furthermore, this epigenetic modulation is disregulated during sporadic breast carcinogenesis. Loss of NER is one basis of genomic instability, a required element in cellular transformation, and one that potentially influences response to therapy. In this study, we demonstrate differences in NER capacity in eight adult mouse tissues, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

Thumbnail image of graphical abstract

We have shown profound variation in NER (Nucleotide Excision Repair) capacity in humans, between cell-types and during carcinogenesis. As NER is intimately related to both replication and transcription, it shows a narrow range of functional viability. NER activity and gene expression are epigenetically regulated, although this epigenetic modulation is disregulated during sporadic breast carcinogenesis. We now demonstrate differences in NER capacity in eight adult mouse tissues, including a complete lack of activity in brain, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer.

Quelle: Photochemistry and Photobiology | 19 Dec 2014 | 7:07 am CET

Photocatalytic reduction of CO2 over platinised Bi2WO6-based materials

Photochem. Photobiol. Sci., 2015, 14,678-685
DOI: 10.1039/C4PP00407H, Paper
S. Murcia-Lopez, V. Vaiano, M. C. Hidalgo, J. A. Navio, D. Sannino
Bi2WO6 and Bi2WO6-TiO2 were synthesized, platinised and evaluated in the photocatalytic reduction of CO2. The methane yield was greatly improved by platinisation and TiO2 addition. Blue phosphors enhanced the system stability.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 19 Dec 2014 | 1:00 am CET

Protein-encapsulated bilirubin: paving the way to a useful probe for singlet oxygen

Photochem. Photobiol. Sci., 2015, 14,665-677
DOI: 10.1039/C4PP00408F, Paper
Frederico M. Pimenta, Jan K. Jensen, Michael Etzerodt, Peter R. Ogilby
Oxygen- and singlet-oxygen-dependent parameters that characterize the behavior of bilirubin encapsulated in a protein have been quantified.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 18 Dec 2014 | 1:00 am CET

A study of the Fenton-mediated oxidation of methylene blue-cucurbit[n]uril complexes

Photochem. Photobiol. Sci., 2015, 14,686-692
DOI: 10.1039/C4PP00362D, Paper
Tomas Fuenzalida, Denis Fuentealba
Methylene blue is protected from Fenton oxidation when encapsulated into cucurbit[7]uril or cucurbit[8]uril under dark or UVA irradiation. However, visible light enhances the degradation only when cucurbit[7]uril is present.
The content of this RSS Feed (c) The Royal Society of Chemistry

Quelle: RSC - Photochem. Photobiol. Sci. latest articles | 17 Dec 2014 | 1:00 am CET

Photophysics of Acetophenone Interacting with DNA: Why the Road to Photosensitization is Open

Abstract

Deoxyribonucleic acid photosensitization, i.e. the photoinduced electron- or energy-transfer of chromophores interacting with DNA, is a crucial phenomenon that triggers important DNA lesions such as pyrimidine dimerization, even upon absorption of relatively low-energy radiation. Oxidative lesions may also be produced via the photoinduced production of reactive oxygen species. Aromatic ketones, and acetophenone in particular, are well known for their sensitization effects. In this contribution we model the structural and dynamical properties of the acetophenone/DNA aggregates as well as their spectroscopic and photophysical properties using high-level hybrid quantum mechanics/molecular mechanics methods. We show that the key steps of the photochemistry of acetophenone in gas phase are conserved in the macromolecular environment and thus an ultrafast singlet–triplet conversion of acetophenone is expected prior to the transfer to DNA.

Thumbnail image of graphical abstract

Using a combination of Molecular Dynamics and QM/MM modeling we have characterized stable interaction modes between acetophenone and DNA. The effects of the macromolecular environment on the acetophenone photophysics have been elucidated, confirming that it is still able to efficiently photosensitize DNA by energy transfer from triplet state. In particular this is due to the maintaining of the quasidegenerescence between the first two acetophenone triplet states that are moreover characterized by a high spin-orbit coupling with the ground state. Our work gives important insights in the triplet sensitization mechanism and on the effect of the environment.

Quelle: Photochemistry and Photobiology | 16 Dec 2014 | 9:55 am CET

Beyond Xeroderma Pigmentosum: DNA Damage and Repair in an Ecological Context. A Tribute to James E. Cleaver

Abstract

The ability to repair DNA is a ubiquitous characteristic of life on Earth and all organisms possess similar mechanisms for dealing with DNA damage, an indication of a very early evolutionary origin for repair processes. James E. Cleaver's career (initiated in the early 1960s) has been devoted to the study of mammalian ultraviolet radiation (UVR) photobiology, specifically the molecular genetics of xeroderma pigmentosum and other human diseases caused by defects in DNA damage recognition and repair. This work by Jim and others has influenced the study of DNA damage and repair in a variety of taxa. Today, the field of DNA repair is enhancing our understanding of not only how to treat and prevent human disease, but is providing insights on the evolutionary history of life on Earth and how natural populations are coping with UVR-induced DNA damage from anthropogenic changes in the environment such as ozone depletion.

Thumbnail image of graphical abstract

Sunlight is one of the most ubiquitous hazards for life on Earth. Although some aspects of solar radiation are beneficial (e.g. photosynthesis, vision, vitamin D synthesis), the ultraviolet B (UVB) component causes substantial damage to DNA resulting in debilitating and lethal effects. All organisms are capable of repairing DNA photoproducts and repair pathways are remarkably similar. While DNA repair research often focuses on human diseases and the development of cancer; solar DNA damage is also an important component of ecosystem health and stability. This review provides an overview of DNA repair in non-mammalian taxa relative to ambient UVB stress.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:44 pm CET

The Efficient Photocatalytic Degradation of Methyl Tert-butyl Ether Under Pd/ZnO and Visible Light Irradiation

Abstract

Methyl tert-butyl ether is a commonly used fuel oxygenate that is present in gasoline. It was introduced to eliminate the use of leaded gasoline and to improve the octane quality because it aids in the complete combustion of fuel by supplying oxygen during the combustion process. Over the past decade, the use of MTBE has increased tremendously worldwide. For obvious reasons relating to accidental spillage, MTBE started to appear as an environmental and human health threat because of its nonbiodegradable nature and carcinogenic potential, respectively. In this work, MTBE was degraded with the help of an advanced oxidation process through the use of zinc oxide as a photocatalyst in the presence of visible light. A mixture of 200 mg of zinc oxide in 350 mL of 50 ppm MTBE aqueous solution was irradiated with visible light for a given time. The complete degradation of MTBE was recorded, and approximately 99% photocatalytic degradation of 100 ppm MTBE solution was observed. Additionally, the photoactivity of 1% Pd-doped ZnO was tested under similar conditions to understand the effect of Pd doping on ZnO. Our results obtained under visible light irradiation are very promising, and they could be further explored for the degradation of several nondegradable environmental pollutants.

Thumbnail image of graphical abstract

The photocatalytic degradation of aqueous MTBE solution was studied using zinc oxide as a photocatalyst. Complete MTBE removal was achieved within 9 h under visible light irradiation using ZnO particles. MTBE removal is attributed to the visible light excitation of the photocatalyst resulting in the generation of photoexcited electron/hole pairs. This method can be considered as an efficient and complete removal system of MTBE from water.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:38 pm CET

Minimum Exposure Limits and Measured Relationships Between the Vitamin D, Erythema and International Commission on Non-Ionizing Radiation Protection Solar Ultraviolet

Abstract

The International Commission on Non-Ionizing Radiation Protection (ICNIRP) has established guidelines for exposure to ultraviolet radiation in outdoor occupational settings. Spectrally weighted ICNIRP ultraviolet exposures received by the skin or eye in an 8 h period are limited to 30 J m−2. In this study, the time required to reach the ICNIRP exposure limit was measured daily in 10 min intervals upon a horizontal plane at a subtropical Australian latitude over a full year and compared with the effective Vitamin D dose received to one-quarter of the available skin surface area for all six Fitzpatrick skin types. The comparison of measured solar ultraviolet exposures for the full range of sky conditions in the 2009 measurement period, including a major September continental dust event, show a clear relationship between the weighted ICNIRP and the effective vitamin D dose. Our results show that the horizontal plane ICNIRP ultraviolet exposure may be used under these conditions to provide minimum guidelines for the healthy moderation of vitamin D, scalable to each of the six Fitzpatrick skin types.

Thumbnail image of graphical abstract

The relationship between vitamin D dose and the International Commission on Non-Ionizing Radiation Protection (ICNIRP) UV exposure is studied from measurements made in Southern Queensland, Australia. The measurements take into account all weather and atmospheric conditions including a major continental dust storm event (NASA MODIS Terra image, 23 September 2009). Personal minimum exposure guidelines for the optimal production of vitamin D are presented for each of the internationally recognized UV index ranges relative to the received ICNIRP exposure. The measured data show that the healthy production of vitamin D can be maintained at subtropical latitude without exceeding ICNIRP exposure guidelines.

Quelle: Photochemistry and Photobiology | 11 Dec 2014 | 12:37 pm CET

Ultraviolet Index and Location are Important Determinants of Vitamin D Status in People with Human Immunodeficiency Virus

Abstract

This study aimed to document the vitamin D status of HIV-infected individuals across a wide latitude range in one country and to examine associated risk factors for low vitamin D. Using data from patients attending four HIV specialist clinics across a wide latitude range in Australia, we constructed logistic regression models to investigate risk factors associated with 25(OH)D < 75 nmol L−1. 1788 patients were included; 87% were male, 76% Caucasian and 72% on antiretroviral therapy. The proportion with 25(OH)D < 50 nmol L−1 was 27%, and <75 nmol L−1 was 54%. Living in Melbourne compared with Cairns (adjusted odds ratio (aOR) 3.30; 95% CI 2.18, 4.99, < 0.001) and non-Caucasian origin (aOR 2.82, 95% CI 2.12, 3.75, < 0.001) was associated with an increased risk, while extreme UV index compared with low UV index was associated with a reduced risk (aOR 0.33; 95% CI 0.20, 0.55, < 0.001) of 25(OH)D < 75 nmol L−1. In those with biochemistry available (n = 1117), antiretroviral therapy was associated with 25(OH)D < 75 nmol L−1; however, this association was modified by serum cholesterol status. Location and UV index were the strongest factors associated with 25(OH)D < 75 nmol L−1. Cholesterol, the product of an alternative steroid pathway with a common precursor steroid, modified the effect of antiretroviral therapy on serum 25(OH)D.

Thumbnail image of graphical abstract

Low vitamin D is commonly found in people with HIV. This figure presents the unadjusted proportions of people with 25(OH)D <75 nmol L−1 grouped by UV index categories and the four different study locations in Australia [Cairns (latitude 17°S), Nambour (27°S), Brisbane (28°S) and Melbourne (38°S)]. In this study, we describe these and other factors contributing to serum 25(OH)D levels in people with HIV in Australia. Antiretroviral therapy was also associated with 25(OH)D <75 nmol L−1 which appeared to be modified by cholesterol and warrants further exploration in future studies.

Quelle: Photochemistry and Photobiology | 9 Dec 2014 | 7:22 am CET

Transition from Charge-Transfer to Largely Locally Excited Exciplexes, from Structureless to Vibrationally Structured Emissions

Abstract

Exciplexes of 9,10-dicyanoanthracene (DCA) with alkylbenzene donors in cyclohexane show structureless emission spectra, typical of exciplexes with predominantly charge-transfer (CT) character, when the donor has a relatively low oxidation potential (Eox), e.g. hexamethylbenzene (HMB). With increasing Eox and stronger mixing with a locally excited (LE) state, vibrational structure begins to appear with 1,2,3,5-tetramethylbenzene and becomes prominent with p-xylene (p-Xy). A simple theoretical model reproduces the spectra and the radiative rate constants, and it reveals several surprises: Even in this nonpolar solvent, the fractional CT character of a highly mixed exciplex varies widely in response to fluctuations in the microscopic environment. Environments that favor the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. It is known that sparsely substituted benzene radical cations, e.g., p-Xy•+, are stabilized more in acetonitrile than the heavily substituted HMB•+. Remarkably, ion pairing with DCA•– in cyclohexane leads to even larger differences in the stabilization of these radical cations. The spectra of the low-Eox donors are almost identical except for displacements that approximately equal the differences in Eox, even though the exciplexes have varying degrees of CT character. These similarities result from compensation among several nonobvious, but quantified factors.

Thumbnail image of graphical abstract

Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (Eox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher Eox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-Eox spectra is illusory, resulting instead from several compensating factors.

Quelle: Photochemistry and Photobiology | 8 Dec 2014 | 7:01 am CET

Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study

Abstract

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.

Thumbnail image of graphical abstract

G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K+ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Following Oxygen Consumption in Singlet Oxygen Reactions via Changes in Sensitizer Phosphorescence

Abstract

This work reports an examination of singlet oxygen reactions with amino acid substrates by a method involving measurement of the change in phosphorescence intensity of the singlet oxygen sensitizer. The sensitizer, a Ru(II) bipyridyl complex covalently linked to pyrene, has long-lived phosphorescence in N2 purged aqueous solutions (τ0 ~ 20 μs) that is nearly completely quenched by oxygen in aerated solutions. Irradiation of the complex in water containing sub mM concentrations of histidine, tryptophan and methionine results in a dramatic, easily visible increase in the phosphorescence intensity over a period of 10–100 s. Rate constants for singlet oxygen oxidation of each of the substrates can be obtained by using changes in the phosphorescence intensity in initial rate kinetic analysis. Rate constants obtained in this way compare favorably with those reported in the literature. The method represents a very simple approach for obtaining rate constants for singlet oxygen reactions with various substrates and the kinetics can be extended to nonaqueous solvents.

Thumbnail image of graphical abstract

Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

Quelle: Photochemistry and Photobiology | 28 Nov 2014 | 7:17 am CET

Interspecific Variation in the Repair of UV Damaged DNA in the Genus Xiphophorus as a Factor in the Decline of the Rio Grande Platyfish

Abstract

The fish genus Xiphophorus consists of 26 species distributed along the eastern slopes of mountain ranges extending from northern Mexico to Belize and Nicaragua. We analyzed light-dependent repair of UV-induced DNA damage in at least two species from each of the four monophyletic Xiphophorus groups. We found that the northern platyfish had significantly reduced photoenzymatic repair compared to the other three groups, including the northern swordtails, southern platyfish and southern swordtails. All of the species of the northern platyfish, including the Marbled (meyeri), Northern (gordoni) and Monterrey Platyfish (couchianus) are the northernmost species in the genus and are the only three species in the genus that are currently found on the IUCN Red List of Threatened Species. Satellite data from the past 30 years (1979–2008) correlate greater increases in shorter wavelength UVB with higher latitudes within the Xiphophorus range. We suggest that, combined with other consequences of human population growth, anthropogenic deozonation resulting in a disproportionate increase in UVB in temperate latitudes may be a contributing factor in the decline and extirpation of the northern platyfish.

Thumbnail image of graphical abstract

Geographical distribution of 26 species of the genus Xiphophorus with three northern species is highlighted. The three species comprising the Rio Grande Platyfish are the only Xiphophorus listed on the IUCN Red List of Threatened Species and this clade as a whole displays significantly reduced DNA repair compared to the other species in the genus.

Quelle: Photochemistry and Photobiology | 25 Nov 2014 | 7:50 am CET

o-Amino Analogs of Green Fluorescence Protein Chromophore: Photoisomerization, Photodimerization and Aggregation-induced Emission

Abstract

The photochemical properties of three o-amino analogs of the green fluorescence protein chromophore O0, O1 and O8 (o-ABDIs) have been investigated and compared with those of the m- and p-amino isomers (m-ABDIs and p-ABDIs) in solutions, aggregates, and the solid state. In aprotic solvents, the fluorescence competes with the Z [RIGHTWARDS ARROW] E photoisomerization for all cases, and the o-ABDIs display a fluorescence quantum efficiency of 1–6%, lying between the m-ABDIs of 5–48% and the p-ABDIs of < 0.1%. The fluorescence of both the o- and m-ABDIs is nearly quenched in protic solvents, attributable to the solvent–solute hydrogen bonding (SSHB) interactions. The phenomenon of aggregation-induced emission observed for O8 in poor solvents resembles the behavior of M8 as a consequence of exclusion of the SSHB interactions and restriction of internal rotation for molecules located inside the aggregates. The occurrence of [2 + 2] photodimerization for O0 in the solid state is unique among the ABDIs, and the X-ray crystal structures of O0 and the photodimer OD reveal the head-to-tail syn-oriented stereochemistry. Analysis on the X-ray crystal structures of O0, O1, M0, M1 and P0 shows that not only the pairwise topochemical geometry but also the columnar packing mode is important in determining the photodimerization reactivity.

Thumbnail image of graphical abstract

The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

Quelle: Photochemistry and Photobiology | 24 Nov 2014 | 10:10 am CET

Photoisomerization of cis-1,2-di(1-Methyl-2-naphthyl)ethene at 77 K in Glassy Media

Abstract

cis-1,2-Di(1-methyl-2-naphthyl)ethene, c-1,1, undergoes photoisomerization in methylcyclohexane, isopentane and diethyl ether/isopentane/ethanol glasses at 77 K. On 313 nm excitation the fluorescence of c-1,1 is replaced by fluorescence from t-1,1. Singular value decomposition reveals that the spectral matrices behave as two component systems suggesting conversion of a stable c-1,1 conformer to a stable t-1,1 conformer. However, the fluorescence spectra are λexc dependent. Analysis of global spectral matrices shows that c-1,1 is a mixture of two conformers, each of which gives one of four known t-1,1 conformers. The λexc dependence of the c-1,1 fluorescence spectrum is barely discernible. Structure assignments to the resolved fluorescence spectra are based on the principle of least motion and on calculated geometries, energy differences and spectra of the conformers. The relative shift of the c-1,1 conformer spectra is consistent with the shift of the calculated absorption spectra. The calculated structure of the most stable conformer of c-1,1 agrees well with the X-ray crystal structure. Due to large deviations of the naphthyl groups from the ethenic plane in the conformers of both c- and t-1,1 isomers, minimal motion of these bulky substituents accomplishes cis [RIGHTWARDS ARROW] trans interconversion by rotation about the central bond.

Thumbnail image of graphical abstract

One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

Quelle: Photochemistry and Photobiology | 21 Nov 2014 | 6:53 am CET

Comparison of Templating Abilities of Urea and Thioruea During Photodimerization of Bipyridylethyelene and Stilbazole Crystals

Abstract

Photodimerization of cocrystals of four bispyridylethylenes and two stilbazoles with urea as a template in the solid state has been investigated following our success with thiourea. Four investigated olefins photodimerized quantitatively to a single dimer in the crystalline state only. The reactivity of urea–olefin crystals is understood on the basis of their packing arrangements in the crystalline state. In reactive crystals the adjacent reactive molecules are within 4.2 Å and parallel, whereas the unreactive ones have their adjacent molecules are farther than 4.6Å and nonparallel. Thus, with the knowledge of crystal packing the reactivity of urea–olefin crystals is predictable on the basis of Schmidt's topochemical postulates. The templating property of urea, similar to thiourea, derives from its ability to form hydrogen bonds with itself and the guest olefins. Despite the similarities in molecular structures of urea and thiourea their subtle electronic properties, yet to be fully understood, affect the crystal packing and consequently their reactivity in the crystalline state. Further work is needed to fully exploit the templating properties of urea.

Thumbnail image of graphical abstract

Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

Quelle: Photochemistry and Photobiology | 7 Nov 2014 | 2:22 pm CET

Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins

Abstract

The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's ketone linkers have been investigated by means of steady state and time-resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well-stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases.

Thumbnail image of graphical abstract

The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

Quelle: Photochemistry and Photobiology | 31 Oct 2014 | 5:46 am CET

Photo-Wolff Rearrangement of 2-Diazo-1,2-naphthoquinone: Stern–Volmer Analysis of the Stepwise Reaction Pathway

Abstract

2-Diazo-1,2-naphthoquinone (1) and its derivatives are the photoactive components in Novolak photoresists. A femtosecond infrared study has established that the photoreaction of 1 proceeds largely by a concerted Wolff rearrangement yielding the ketene 1H-inden-1-ylidene-methanone (3) within 300 fs after excitation, but earlier trapping studies gave evidence for a minor reaction path via a carbene intermediate 1-oxo-2(1H)-naphthalenylidene (2) with a lifetime of about 10 ps. Here, we provide a quantitative assessment of the stepwise pathway by Stern–Volmer analysis of the trapping of 2 by methanol to yield 2-methoxy-1-naphthol (4). We conclude that the lifetime of the carbene 2 is at least 200 ps. Moreover, [3 + 2]cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was observed. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Thumbnail image of graphical abstract

A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Quelle: Photochemistry and Photobiology | 30 Sep 2014 | 12:24 pm CEST

A New Series of Fluorescent Indicators for Super Acids

Abstract

The photophysical properties of fluorescent Hammett acidity indicator derived from 3,4,5,6-tetrahydrobis(pyrido[3,2-g]indolo)[2,3-a:3′,2′-j]acridine (1a), 6-bis(pyrido[3,2-g]indol-2′-yl)pyridine (1b) and their analogues have been investigated in sulfuric acid solutions by means of absorption, fluorimetry, relaxation dynamics and computational approach. These new indicators undergo a reversible protonation process in the Hammett acidity range of H0 < 0, accompanied by a drastic increase of the bright blue-green (1a) or yellow (1b) fluorescence intensity upon increasing the acidity. For 1a in H2SO4, the emission yield increases as large as 200 folds from pH = −0.41 to the Hammett acidity range of −5.17, the results of which are rationalized by a much increase of the steric hindrance upon third protonation toward the central pyridinic site, together with their accompanied changes of electronic configuration from charge transfer to a delocalized ππ* character in the lowest lying excited state. The combination of 1a and 1b renders a wide and linear range of H0 measurement from −1.2 to −5.1 detected by highly intensive fluorescence.

Thumbnail image of graphical abstract

A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pKa as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

Quelle: Photochemistry and Photobiology | 6 Sep 2014 | 2:11 pm CEST

Xeroderma Pigmentosum in the United Kingdom

Abstract

The seminal discovery by James Cleaver of defective DNA repair in xeroderma pigmentosum (XP) opened up an ever-expanding field of DNA repair-related disorders. In addition, it put XP on the map and has led to improved diagnosis, care and management of affected patients. In the United Kingdom, we recently established a multidisciplinary specialist clinic for XP patients. All XP patients in the United Kingdom are able to visit the clinic where they are examined and advised by a team of specialists with detailed knowledge of the different aspects of XP.

Thumbnail image of graphical abstract

Early diagnosis and rigorous protection from daylight can completely prevent the skin problems in XP. Patient XP59BR (left) has had poor protection from daylight and has developed many skin cancers. In contrast, patient XPJCLO was diagnosed in his first year of life, has been rigorously protected from sunlight and has not developed any significant skin lesions. Curiously, despite having similar mutations in the XPD gene, XP59BR has no severe neurological problems, whereas XPJCLO has shown features of neurological degeneration since the age of 2. Photographs published with consent of patient or their family.

Quelle: Photochemistry and Photobiology | 14 Jul 2014 | 7:37 am CEST

Effect of Light on Expression of Clock Genes in Xenopus laevis Melanophores

Abstract

Light-dark cycles are considered important cues to entrain biological clocks. A feedback loop of clock gene transcription and translation is the molecular basis underlying the mechanism of both central and peripheral clocks. Xenopus laevis embryonic melanophores respond to light with melanin granule dispersion, response possibly mediated by the photopigment melanopsin. In order to test whether light modulates clock gene expression in Xenopus melanophores, we used qPCR to evaluate the relative mRNA levels of Per1, Per2, Clock and Bmal1 in cultured melanophores exposed to light-dark (LD) cycle or constant darkness (DD). LD cycles elicited temporal changes in the expression of Per1, Per2 and Bmal1. A 10-min pulse of blue light was able to increase the expression of Per1 and Per2. Red light had no effect on the expression of these clock genes. These data suggest the participation of a blue-wavelength sensitive pigment in the light-dark cycle-mediated oscillation of the endogenous clock. Our results add an important contribution to the emerging field of peripheral clocks, which in non-mammalian vertebrates have been mostly studied in Drosophila and Danio rerio. Within this context, we show that Xenopus laevis melanophores, which have already led to melanopsin discovery, represent an ideal model to understanding circadian rhythms.

This article is protected by copyright. All rights reserved.

Quelle: Photochemistry and Photobiology | 26 Dec 2013 | 1:09 pm CET




 


Sonstige Hinweise:


Ueber diese Seite:

 

Urheber und Verantwortlich fuer die Inhalte der verlinkten Artikel sind die in den Quellen genannten Anbieter.

 

Hinweise zur Veroeffentlichung Ihrer Pressemitteilung im Bereich Chemie und angrenzende Fachgebiete

Update:

08.10.2009

Thema:

Chronologische Liste mit Fachartikeln zum Thema Photochemie.

Benutzerdefinierte Suche

Internetchemie Copyright: 2007 - 2009 A. J.